Skip to main content
Addgene

We narrowed to 14 results for: Met

Showing: 1 - 14 of 14 results
  1. Molecular Biology Reference

    Type
    Guide
    ...UUG, CUU, CUC, CUA, CUG Lysine Lys K AAA, AAG Methionine Met M AUG Phenylalanine Phe F UUU, UUC Proline ...To learn more about different types of cloning methods check out our guide on molecular cloning techniques...developed the process termed Sanger sequencing, sometimes referred to as chain-termination sequencing or... making it an efficient and reliable sequencing method. Next Generation Sequencing Although Sanger sequencing... 5 factors to help you choose the right cloning method Plasmids 101: Restriction Cloning Plasmids 101:...
  2. Antibody Guide

    Type
    Guide
    ...Overview Quantification Methods Capture Methods Visualization Methods Cell Sorting Methods Multiplex Assays ...Antibody Applications - Cell Sorting Methods Flow cytometry Flow cytometry, used commonly in immunology, allows... through the indirect detection method. In the direct detection method, the signaling molecule is conjugated...Antibody Applications - Quantification Methods Quantification methods, such as western blots or ELISAs, are...output measured. This method can be performed using the indirect detection method via a conjugated secondary...sample. Controls for quantification methods Quantification methods should be run with: a positive control...included. Antibody Applications - Capture Methods Capture methods such as immunoprecipitation (IP) and chromatin...
  3. CRISPR Guide

    Type
    Guide
    ...toxins, cell viability, and tumor metastasis. One of the most popular methods for conducting genome-wide screens...activation through cytosine demethylation DNMT3A - repression through cytosine methylation MQ1 - repression through... to conventional methods for genomic purification, CRISPR-based purification methods are more straightforward... currently no defined measure of fidelity, so sometimes they will be referred to as increased fidelity...Cas9’s proofreading capabilities. No matter the method, increased fidelity enzymes generate less off-target... editing is a “search and replace” gene editing method in which Moloney Murine Leukemia Virus Reverse ...Although lentiviral libraries are the most popular method for CRISPR screening, they are not suitable for...
  4. Cloning

    Type
    Guide
    ...including information on seven commonly used cloning methods....how do scientists recombine DNA? There are many methods that have been utilized over the years to move ...Check out our blog on choosing the right cloning method for your research project . The following guide... highlight several of the most popular cloning methods used to create recombinant DNA. Restriction Enzyme...based molecular cloning is the "classic" cloning method, and for many reasons, remains one of the most ...can be time consuming compared to other cloning methods. You can find a protocol for restriction cloning...Gateway® cloning is a recombination based cloning method. The benefit of Gateway® is that moving a piece...
  5. Lentiviral Vector Guide

    Type
    Guide
    ...multiplexable method for genome-wide mapping of lentiviral integration sites. Molecular Therapy — Methods & Clinical...plasmid can be done with most standard cloning methods, including restriction enzyme, Gibson Assembly,...or may only be compatible with certain cloning methods (such as a Gateway destination vector), so be sure...your chosen plasmid is compatible with cloning methods available in your lab. When cloning your plasmids...HEK293T cells using your preferred transfection method. The HEK293T cells will produce the viral vectors...screens, lentiviral vectors are a preferred delivery method when conducting cellular barcoding experiments....lentiviral vectors, they have been seen as an effective method for in vivo gene delivery. Lentiviral vectors are...
  6. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...viral replication (E4, E2a and VA). These are sometimes combined within the packaging plasmid. For a summary...plasmid can be done with most standard cloning methods, including restriction enzyme, Gibson Assembly,...or may only be compatible with certain cloning methods (such as a Gateway destination vector), so be sure...your chosen plasmid is compatible with cloning methods available in your lab. When cloning your plasmids...mutations or insertions in the Cap region. Several methods have been developed and successfully employed to...and a systemic AAV capsid could avoid invasive methods such as intracranial injection. Systemic capsids...Cas9 elements, making it one of the most common methods for in vivo CRISPR-based genome editing. Packaging...
  7. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...plasmid can be done with most standard cloning methods, including restriction enzyme, Gibson Assembly,...or may only be compatible with certain cloning methods (such as a Gateway destination vector), so be sure...your chosen plasmid is compatible with cloning methods available in your lab. When cloning your plasmids...cells (Figure 3A), similar to lentiviral packaging methods . The three plasmids described above (envelope,...these genes on separate plasmids ( in trans ). This method, therefore, reduces the number of plasmids that...pseudotyping. Figure 3: Gamma-retroviral vector packaging methods. Created with BioRender.com. Viral Vector Integration...protocol is for lentiviral vectors, but a similar method can be applied when using gamma-retroviral vectors...
  8. Adenovirus Guide

    Type
    Guide
    ...most popular choice due to their well-established methods, relative simplicity of production, and higher ...from the HV in final viral preparations. Several methods to avoid HV contamination have been developed, ...plasmid can be done with most standard cloning methods, including restriction enzyme, Gibson Assembly,...or may only be compatible with certain cloning methods (such as a Gateway destination vector), so be sure...your chosen plasmid is compatible with cloning methods available in your lab. When cloning your plasmids... by Bert Vogelstein’s lab , is the most popular method for creating first-generation rAdV vectors, which...supercoiled pAdEasy and the shuttle plasmid, but this method results in a higher background of non-recombinant...
  9. Plan Your Experiment

    Type
    Guide
    ...selectable marker (drug or fluorophore) Delivery method Expression System Components of System Application...dividing and non-dividing cells AAV is the least toxic method for in vivo viral delivery RNA delivery of Cas9...Once you have selected your CRISPR components and method of delivery, you are ready to select a target sequence...depositors ). Deliver Cas9 and gRNA Choose a delivery method that is compatible with your experimental system...system. CRISPR efficiency will vary based on the method of delivery and the cell type. Before proceeding ... that your desired edit has occurred? The exact method necessary to validate your edit will depend upon.... Genome engineering using CRISPR-CAS9 system. Methods in Molecular Biology . 1239 , 197–217. PMID: 25408407...
  10. Chemogenetics Guide

    Type
    Guide
    .... However, CNO is back-metabolized to clozapine and other clozapine metabolites and these can have off-target...concentrations of clozapine N ‐oxide (CNO). CNO is a metabolite of the antipsychotic clozapine and seems to be...experiments in this species may be entirely due to back-metabolism of CNO to clozapine, demonstrating the need for...activity, and do not seem to have the same back-metabolism issues as CNO and are attractive alternatives...2004). The highly efficacious actions of N-desmethylclozapine at muscarinic receptors are unique and not...
  11. Optogenetics Guide

    Type
    Guide
    ...excitation of distinct neural populations. Nat Methods. 11(3):338-46. PMID 24509633 Lin, J. 2011. A User... comparative analysis of microbial opsins. Nat Methods. 9(2):159-72. PMID 22179551 Saunders A, Johnson...2016. Enhancing Channelrhodopsins: An Overview. Methods Mol Biol. 1408:141-65. PMID 26965121 Yizhar O, ...
  12. Sequencing Primers

    Type
    Guide
    ...CATCTCAGTGCAACTAAA (Invitrogen) Drosophila metallothionein promoter, forward primer MMLV-F ATCAGTTCGCTTCTCGCTTC...reverse primer MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC...
  13. Guide to Using Pooled Libraries

    Type
    Guide
    ...screens. Both types of screen employ a selection method relevant to the phenotype being studied. Examples...
  14. Promoters

    Type
    Guide
    ...Inducible by arabinose Promoter of the arabinose metabolic operon trp Repressible by tryptophan Promoter ...
Showing: 1 - 14 of 14 results