Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 916 results for: tro

Showing: 861 - 880 of 916 results

  1. DNA Quantification

    Type
    Protocol
    ...purity. This can be done with a spectrophotometer. A spectrophotometer uses the absorbance/transmission... instructions for the spectrophotometer specific to your lab. Spectrophotometer Tips Before measuring ...labs have a NanoDrop, which is a very small spectrophotometer that can accurately read DNA concentration...measuring any samples, be sure to ‘blank’ the spectrophotometer using the solution the DNA is resuspended in, ...NanoDrop. It is a good idea to re-zero any spectrophotometer between samples if they are expected to vary...

  2. Plasmid Cloning by PCR (with Protocols)

    Type
    Protocol
    ...an uncut sample of each vector to help with troubleshooting if your digests don’t look as you expected....product is the anticipated size and that your band is strong (indicating that the PCR reaction worked and that...insert. It is also important to set up negative controls in parallel. For instance, a ligation of the recipient...much less total DNA (<1ng) or if you are having trouble getting colonies, you might want to use higher ...to be very large (>10kb) you might want to use electro-competent cells instead of the more common chemically-competent...plasmid alone plate. The recipient plasmid alone control will tell you your “background” level or more specifically...see any colonies, you should conduct a positive control to ensure that your transformation worked. You ...

  3. Protocol - How to Perform a Diagnostic Digest

    Type
    Protocol
    ...Restriction Digest of Plasmid DNA Agarose Gel Electrophoresis Introduction Restriction enzymes are naturally occurring...and analyze the resulting fragments by gel electrophoresis . The pattern of the fragments on the gel can...to analyze a restriction digest. Equipment Electrophoresis chamber Pipetman Pipet tips Reagents Liquid...manufacturer's instructions) Gel loading dye Electrophoresis buffer Verifying Total Plasmid Size -OR- Insert...avoided. If you do have to do so, there is no way to control which orientation the insert is ligated into the... tricks see the Restriction Digest and Gel Electrophoresis pages....

  4. Plasmid Cloning by Restriction Enzyme Digest (with Protocols)

    Type
    Protocol
    ... uncut sample of each plasmid to help with troubleshooting if your digests don’t look as you expected....insert. It is also important to set up negative controls in parallel. For instance, a ligation of the recipient...much less total DNA (<1ng) or if you are having trouble getting colonies, you might want to use higher ...to be very large (>10kb) you might want to use electro-competent cells instead of the more common chemically-competent...plasmid alone plate. The recipient plasmid alone control will tell you your “background” level or more specifically...see any colonies, you should conduct a positive control to ensure that your transformation worked. You ...depending on the number of background colonies on your control plate (the more background, the more colonies you...

  5. Western Blot

    Type
    Protocol
    ...channel pipette Pipette controller Pipette tips and pipettes Spectrophotometer Heat block Mini gel tank...Protocol Recombinant Antibody Purification Protocol Introduction Western blot is a technique used to separate...ladder. Place the lid on the tank and plug the electrode cords into the power supply. Run the gel at 100... a dark room to detect the bands. Tips and Troubleshooting The optimal lysis buffer will vary depending...as expected and is specific, include a positive control sample that you know expresses the protein, such...transfected with the protein of interest, and a negative control sample that does not express the protein of interest...

  6. Lentivirus ddPCR Titration

    Type
    Protocol
    ...Viral Service Lentivirus Guide Virus Blog Posts Introduction This protocol describes how to use droplet digital...ribonuclease P/MRP 30 kDa subunit (RPP30) are used as a control for normalization. The dilution series outlined...wells containing the virus and the untransduced control. Pro-Tip For even seeding, prepare a batch for ...Determine the concentration of each sample on a spectrophotometer. Prepare 25 ng/µL stocks of each sample. Samples...calculate the final infectious titer. Tips and Troubleshooting We recommend wiping down all pipettes and equipment...concentration of RRE positive droplets in the untransduced control should be close to zero (A01). In this protocol...

  7. Sequencing Primers

    Type
    Guide
    ...beta-globin intron, forward primer Bglob-intron-R TTTGCCCCCTCCATATAACA Rabbit beta-globin intron, reverse...TAGAAGGCACAGTCGAGG (Invitrogen) Bovine growth hormone terminator, reverse primer Bglob-intron-F CTGGTCATCATCCTGCCTTT...CCCAGTCACGACGTTGTAAAACG (Invitrogen) In lacZ gene M13/pUC Reverse AGCGGATAACAATTTCACACAGG (Invitrogen) In lacZ gene...AAATGATAACCATCTCGC (Invitrogen) Polyhedrin promoter, forward primer Polyhedrin reverse GTCCAAGTTTCCCTG (Invitrogen) For...Used Primers CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward ...Full Primer List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse...reverse primer 5'AOX1 GACTGGTTCCAATTGACAAGC (Invitrogen) For Pichia vectors with AOX1 promoter, forward...

  8. Lentiviral Vector Guide

    Type
    Guide
    ... Versus Gamma-Retrovirus Lentiviruses and gamma-retroviruses fall under the Retroviridae family. The genome...Glossary Lentiviruses are a type of retrovirus and belong to the Retroviridae family. Infection with lentiviruses...variety of cell types than retroviruses. Both lentiviruses and gamma-retroviruses use the same packaging ...packaged by gamma-retroviral packaging systems, and vice versa. For more about gamma-retroviruses, see Addgene's...Panch, S. R., Jin, P., & Stroncek, D. F. (2022). Genome-wide profiling of retroviral DNA integration and its..., leading to disease. Lentivirus A retrovirus from the Retroviridae family. Characterized by long incubation...BIV), and feline immunodeficiency virus (FIV). Retroviruses are partially characterized by their ability...

  9. Immunocytochemistry

    Type
    Protocol
    ...Protocol Recombinant Antibody Purification Protocol Introduction Immunocytochemistry is a technique that uses...Day 3-4: Fix and label cells Equipment Pipette controller Pipette tips and pipettes Rocking platform Tweezers... appropriate fluorescent filters. Tips and Troubleshooting The optimal fixation method will vary depending...functioning as expected and specific, include a positive control sample that you know expresses the protein, such...express the protein of interest, and a negative control sample such as cells that do not express the protein...

  10. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...studied, and has a broad tissue tropism. Table 1 gives a summary of the tropism of AAV serotypes, indicating...variant able to display neuronal retrograde transport, AAVrg. Retrograde transport refers to the direction...disease, spinal muscular atrophy, hemophilia A and B, and Duchenne muscular dystrophy. Many clinical trials...injection. Different AAV serotypes exhibit strong neuronal tropism, meaning they can efficiently target specific...therefore non-pathogenic and generally do not trigger a strong immune response. These features have made AAVs ...are transfected into cells which then act as in vitro factories for the new viral particles in the laboratory...serotypes are AAV variants that differ in their tropism — that is, the types of cells they infect. Serotypes...

  11. Antibody Guide

    Type
    Guide
    ...negative control. The negative control may be a no-antibody control in which a sample is processed without ...standard curve can serve as the positive control); and a negative control, a sample known not to contain your...interest. The negative control should be biological (no protein expressed), which controls for your antibody...fragmentation of the DNA. Controls for capture methods Capture methods should use a positive control and a negative...addition to the control used in standard IP, ChIP should additionally use a beads-only control which runs ...the machine. Controls for cell sorting methods Flow cytometry requires a negative control, a small subset...animal’s immune system. The antigen of interest is introduced to the animal, which then mounts an immune response...

  12. Colony Formation Titering Assay

    Type
    Protocol
    ...Virus Blog Posts Mol Bio Protocols Viral Service Introduction This protocol can be used to titer lentivirus...titer of your lentiviral preparation allows you to control the multiplicity of infection (MOI) in downstream...channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container Reagents DMEM high ...All of the cells in the untransduced (negative) control well should be killed and no colonies should be...appropriate antibiotic. When the untransduced (negative control) cells have died and colonies are visible in the...

  13. Optogenetics Guide

    Type
    Guide
    ...Optogenetics Guide Introduction Microbial Opsins Optical Switches References Introduction The field of optogenetics...research utilize light to detect, measure, and control molecular signals and cells in order to understand... genetically-encoded tools for light-activated control of proteins; e.g., microbial opsins and optical...These various opsins also initiate different electrochemical responses, such as nonspecific cation influx...subsets of neurons, allowing precise spatiotemporal control of these neurons by turning on and off the light...Wild-type halorhodopsin, known as NpHR (from Natronomonas pharaoni ), causes hyperpolarization (inhibition.../NpHR Light-driven inward chloride pump from Natronomonas pharaonis , used to silence neuronal activity...

  14. Kit Free RNA Extraction

    Type
    Protocol
    ...Gel Purification Molecular Biology Reference Introduction This protocol describes how to extract RNA from...unlike using a p1000 tip it will give you more control of where you’re aiming your tip in the tube. Precipitate...the quality of your RNA sample(s) using a spectrophotometer (such as a Nanodrop), agarose gel, or bioanalyzer...

  15. Molecular Biology Reference

    Type
    Guide
    ...is also important for controlling the level of insert expression (i.e., a strong promoter directs high...BL21 Invitrogen; New England BioLabs E. coli B F dcm ompT hsdS(rB mB) gal ccdB Survival Invitrogen F- mcrA...Genetics Plasmid Elements Working with Plasmids Introduction Types of Plasmids E. coli strains for propagating...genes as carriers of phenotypic information was introduced in the early 19th century by Gregor Mendel, who...of restriction enzymes, DNA ligase, and gel electrophoresis allowed for the ability to move specific fragments...that the antibiotic resistance gene is under the control of a bacterial promoter, and is thus expressed ...antibiotic resistance gene (this time, under the control of a non-bacterial promoter) or a fluorescent protein...

  16. Protocol - How to Purify DNA from an Agarose Gel

    Type
    Protocol
    ...gel electrophoresis, which separates DNA by their length in base pairs. Following electrophoresis, you...Restriction Digest of Plasmid DNA Agarose Gel Electrophoresis DNA Ligation Background Information Gel purification...Protocol: Gel Purification Follow the Agarose Gel Electrophoresis Protocol with the following amendments: Notes...

  17. Video Library

    Type
    Protocol
    ... Technology Protocol Agarose Gel Electrophoresis Gel electrophoresis is the standard laboratory procedure...visualization and purification. Agarose Gel Electrophoresis Protocol Purifying DNA from an Agarose Gel ...DNA fragments based on size. Following gel electrophoresis, you can cut DNA bands out of the agarose gel...

  18. Promoters

    Type
    Guide
    ...Transcription is tightly controlled in both bacteria and eukaryotes. Promoters are controlled by various DNA regulatory...Constitutive Strong mammalian promoter from human cytomegalovirus EF1a Constituitve Strong mammalian promoter...vital component of expression vectors because they control the binding of RNA polymerase to DNA. RNA polymerase...a functional protein. Thus the promoter region controls when and where in the organism your gene of interest... are proteins which recruit RNA polymerase and control and regulate the transcription of DNA into mRNA...human elongation factor 1 alpha CAG Constitutive Strong hybrid mammalian promoter PGK Constitutive Mammalian...consists of the sequence TTGACA and this element controls the rate of transcription. Bacterial cells contain...

  19. Fluorescence Titering Assay

    Type
    Protocol
    ...Virus Blog Posts Mol Bio Protocols Viral Service Introduction This protocol can be used to titer lentiviral... titer of your lentiviral vector allows you to control the multiplicity of infection (MOI) in downstream...channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container Inverted fluorescence...dilution with one well remaining as the untransduced control). Count the cells in the remaining well, a cell...

  20. Adenovirus Guide

    Type
    Guide
    ...Addgene's Blog An Introduction to Adenovirus Adenoviral Vector Production and Troubleshooting Adenoviral Delivery...recognizes adenoviral elements rapidly and can mount a strong immune response quickly, which has limited their...double-stranded circular episomes. Due to this, and to the strong host’s immune response against the transduced cells...G). Different serotypes exhibit varying tissue tropisms, meaning they preferentially infect certain tissues...proteins. Researchers have further refined the tropism of rAdV vectors by mixing capsids and genomes from...vector features such as transduction efficiency, tropism and immunogenicity. For example, Ad5/35 and Ad5...viral vector uptake and transgene expression. This strong immune response has become a disadvantage for the...
Showing: 861 - 880 of 916 results