Skip to main content

We narrowed to 924 results for: TRO

Showing: 901 - 920 of 924 results
  1. Chemogenetics Guide

    Type
    Guide
    ... However, neuronal control through PSAMs and LMOs is direct, while neuronal control of DREADDs is indirect...endogenous signaling, therefore allowing precise control over the cell population they are targeted to. ...used in the same organism to allow bidirectional control of neuronal activity. Table 1. Descriptions of ...chemogenetic receptors that confer more direct control of neurons through manipulation of ion channels...expression of AAV-delivered constructs can be controlled with cell-type specific promoters. Table 4 lists...unwanted cell types. Generating a FLEx switch to control expression of a chemogenetic reporter ensures that...AI, Armbruster BN, Pei Y, et al. (2009). Remote control of neuronal activity in transgenic mice expressing...
  2. Plan Your Experiment

    Type
    Guide
    ...CRISPR Experiment Jump To: Plan Your Experiment Introduction Select Genetic Manipulation Design and Clone...CRISPR experiments and can be used as positive controls when working out a new protocol. Read more about...generally perform by chemical transfection or electroporation. Expression can be transient, or you can generate... of Cas and gRNA. This method involves using in vitro transcription reactions to generate mature Cas mRNA... to target cells through microinjection or electroporation. The target cells translate the mRNA encoding...you directly combine purified Cas protein and in vitro transcribed gRNA to form a Cas-gRNA complex. You...delivery the RNP to cells using cationic lipids, electroporation, or an endosomal approach. Similar to the mRNA...
  3. Guide to Using Pooled Libraries

    Type
    Guide
    ...Library Guide Introduction Library Amplification Types of Screens Resources An Introduction to Pooled Libraries...the screening process. Amplify the library (electroporation and maxiprep). If delivering as virus, make... Perform Next Generation Sequencing (NGS) on a control sample (no selection) In parallel, apply library...cells Compare NGS results between experimental and control cells Generate a list of gRNAs that disappear with... post-selection. The selective pressure must be strong enough that most of the cells die, removing their...selection while the other serves as a non-selected control. These two populations are then sequenced using...Screening Pooled CRISPR Libraries Offer Genome-Wide Control for Large-Scale Functional Screens New Tool for...
  4. Sequencing Primers

    Type
    Guide
    ...Reverse Bglob-intron-F CTGGTCATCATCCTGCCTTT Rabbit beta-globin intron Forward Bglob-intron-R TTTGCCCCCTCCATATAACA...for inserts in pBMN retroviral vector MMLV sequence, for inserts in pBMN retroviral vector Forward pBR322ori-F...TTTGCCCCCTCCATATAACA Rabbit beta-globin intron Reverse Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA... pCAG-F GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids Forward pCasper-F GGGTTTTATTAACTTACAT...pMT2-F TTGCCTTTCTCTCCACAGGT 3' end of synthetic intron Forward pMX-S1811 GACGGCATCGCAGCTTGGATACAC MMLV...
  5. Protocol - How to Streak a Plate

    Type
    Protocol
    ...Recovering Plasmid DNA from Bacterial Culture Introduction If you have a glycerol stock or stab culture...would hold a pencil, so that you can make a broad stroke. Only touch the surface of the plate, do NOT dig...
  6. Protocol - Over-Agar Antibiotic Plating

    Type
    Protocol
    ...Recovering Plasmid DNA from Bacterial Culture Introduction This protocol describes methodology for plating...concentrations of carbenicillin plated over-agar. Control Plate with No Carbenicillin Plate shows a lawn ...
  7. Weighing Reagents Protocol

    Type
    Protocol
    ...Protocols Weighing Reagents Weighing Reagents Protocol Intro to the Lab Bench Check out more protocols and videos...videos to help you get started in the lab! Introduction For many experiments, you’ll need to make buffers...
  8. Water Bath Protocol

    Type
    Protocol
    ... Protocols Water Bath Water Bath Protocol Intro to the Lab Bench Check out more protocols and videos...videos to help you get started in the lab! Introduction A water bath is a piece of laboratory equipment...
  9. Modular Cloning Guide

    Type
    Guide
    .... MoClo Plant Parts Kit Plant Expression Nicola Patron 95 standardized parts specific for plant synthetic...Toolkit Yeast Expression Volker Sieber Plasmids with control elements and fluorescent reporters to be used in...Toolkit Bacterial Expression, Fungal Expression Nili Ostrov , Charlie Gilbert , and Cultivarium Tools 189 plasmids...MoClo-compatible CRISPR/Cas9 cloning kit with intronized Cas9 Genome Engineering, CRISPR Sylvestre Marillonnet...constructs are made with zCas9i, a high efficiency intron-optimized SpCas9-coding gene. MoClo CRISPR/Cas ...Resources Guide to DNA Assembly Techniques by Nicola Patron at The Sainsbury Laboratory Weber E, Engler C, ... M, Gruetzner R, Ehnert TM, Werner S, Jones JD, Patron NJ, Marillonnet S. A golden gate modular cloning...
  10. General Transfection

    Type
    Protocol
    ...Virus Blog Posts Mol Bio Protocols Viral Service Introduction This protocol describes a general method for...channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container Reagents DMEM high ...
  11. Pipetting Protocol

    Type
    Protocol
    ... Protocols Pipetting Pipetting Protocol Intro to the Lab Bench Check out more protocols and videos...videos to help you get started in the lab! Introduction The pipette is an essential tool for nearly anyone...
  12. AAV Purification by Iodixanol Gradient Ultracentrifugation

    Type
    Protocol
    ...Vector Guides Virus Blog Posts Mol Bio Protocols Introduction This protocol can be used to purify AAV of any...VP2, VP3; M protein marker. Image adapted from Strobel Benjamin, Miller Felix D., Rist Wolfgang, and Lamla...
  13. Science Guides

    Type
    Guide
    ...selectively control and investigate cell signaling pathways. Receptors are remotely controlled via small...small molecules, which allows for specific control of activity. Read More CRISPR Class 2 C lustered R egularly...research utilize light to detect, measure, and control molecular signals and cells in order to understand...Lentivirus Adeno-associated Virus (AAV) Adenovirus γ-Retrovirus Read More...
  14. Addgene's eBook Collection

    Type
    Guide
    ...biosensors, and monitoring protein localization; an introduction to non-protein fluorophores; and much more! ...About This guide to viral vectors contains an introduction to each vector and its applications, tips for...for using vectors in your experiments, troubleshooting advice on production and use, and much more! Close...Edition, trans. About Una traducción al español de nuestro libro electrónico, CRISPR 101. Close About Overlay...Edition About Our newest eBook contains practical introductions and helpful tips for antibody-based applications...
  15. AAV ddPCR Titration

    Type
    Protocol
    ...Virus Blog Posts Molecular Biology Reference Introduction This protocol describes how to use droplet digital... and positive droplets (blue). The no template control (NTC) should be close to zero (B08). At Addgene...
  16. AAV Production in HEK293 Cells

    Type
    Protocol
    ...Virus Blog Posts Molecular Biology Reference Introduction This protocol can be used to produce AAV from... cell counter Ice bucket CO 2 incubator Pipet controller Hazardous waste container pH meter Stir plate...
  17. Protocol - How to Design Primers

    Type
    Protocol
    ...Reaction Plasmid Cloning by PCR Agarose Gel Electrophoresis Primer Design for PCR Oligonucleotide primers...
Showing: 901 - 920 of 924 results