We narrowed to 963 results for: form

...added to this list? Fill out our Suggest a Plasmid form or e-mail [email protected] to help us improve this... tags such as fluorescent protein (FP) tags. Information on genes and associated neurodegenerative diseases...SOD1-VC SOD1 Venus CMV ALS Tiago Outeiro 89780 isoform PKC Gamma (JCE692) PRKCG PKC1 Spinocerebellar ataxia...

...from Arabidopsis thaliana is fused to truncated forms of cytosolic STIM1 to control calcium channels ~...UVR8 domains UVR8 plant photoreceptor protein that forms photolabile homodimers with slow reversal kinetics...microbial opsins and optical switches. For more information on biosensors such as calcium indicators or voltage...blue-shifted channelrhodopsin from Platymonas subcordiformis 445 CoChR Channelrhodopsin from Chloromonas...465 SwiChRca Chloride-conducting channel, Step-waveform inhibitory ChR with mutation C128A (derived from...widely used Cry2-CIB1 system, light induces a conformational change in cryptochrome Cry2 to permit CIB1 ...cryptochromes with light-induced changes in protein conformation/dimerization. In addition to the applications...

...consists of two plasmids that eventually recombine to form one: Shuttle/transfer plasmid (e.g. pAdTrack) — ...GFP. Recombinant adenoviral vector (rAdV) Modified form of AdV used to deliver genetic material into cells...of experiments being performed. Your biosafety office can provide more information on your institution'...also made them the most widely used viral vector platform for vaccine design against a diversity of viruses...E1, E4, E2a and VA for replication. For more information about AAVs, read our AAV guide . Recombinant ..., and higher titers. However, the risk of RCA formation is higher for first-generation rAdV vectors than...ccdB-resistant strain is necessary. For more information on cloning and working with plasmids, visit Addgene...

...Restriction Digest of Plasmid DNA Background Information During several different stages of molecular ...

... capabilities. Taking into consideration the information above, primers should generally have the following...

...also like... Making LB Agar Plates Bacterial Transformation Recovering Plasmid DNA from Bacterial Culture...

...You can purchase master mix or make your own. Transform bacteria with the DNA and screen for the correct...

... (am): Observe fluorescence, harvest cells, or perform your experiment Equipment Class II, Type A2 Biological...

... D E Sample 1 Sample 4 F E Sample 2 Sample 5 F Perform data analysis using the instrument’s software. ...

...specific products or equipment. Inclusion of this information is solely for transparency intended to support...

...Follow this protocol to perform digital droplet PCR (ddPCR) for purified AAV titration....

...Forward SFFV-F ATTGATTGACTGCCCACCTC Spleen focus forming virus 5' LTR Forward SP6 ATTTAGGTGACACTATAG SP6...Email us at [email protected] . For additional information on molecular biology, plasmids, and recombinant...

...serotypes are harvested at 96–120 h. Optional: perform a media exchange at ~18 h post transfection. Changing...

...ll express your gRNA and Cas9 protein, which will form a ribonucleoprotein complex through interactions...effector, composed of several separate Cas enzymes that form a complex called Cascade (see Cas3 for more details...with Cas3 Rather than initiating DNA cleavage to form a break, Cas3 initiates single-strand DNA degradation...dCas9 Nuclease dead Cas9, an enzymatically inactive form of Cas9; can bind, but cannot cleave DNA DSB D ouble...Cas9 undergoes a second conformational change upon target binding. In this formation, its nuclease domains...detection platform. Based on this non-specific cleavage, a Cas13a-based molecular detection platform, termed...positively-charged grooves on Cas9. gRNA binding induces a conformational change in Cas9, shifting it into an active,...

...repetitive sequences and DNA that ends in sequences that form complex secondary structures. Read more in our SLIC... with four nicks that bacteria repair after transformation. LIC does not require site-specific recombination... is rendered unnecessary. The product may be transformed directly into E. coli , where the normal replication... recombination abilities of yeast. By simply transforming into yeast two (or more) fragments of dsDNA ...than 10 kb. Another advantage is the ability to perform oligonucleotide stitching, in which pieces of DNA... seamless manner. To accomplish this, you can transform into yeast the fragments of DNA to be fused along...

...modules can be assembled into a Level 2 vector, forming a functional genetic circuit. Level 2 vectors are...E. coli to maintain the final plasmid after transformation. Figure 1: Overview of the MoClo Toolkit components...multigene constructs. MoClo Plant Parts III: Transformation & Genome Engineering Kit Plant Expression, ...plasmids with multi-gene constructs for plant transformation. GoldenBraid 2.0 Kit Plant Expression, CRISPR...Daniel Voytas 76 plasmids for assembling plant transformation vectors for overexpression, gene editing, functional...Expression, Mammalian Expression Stephan Gruber Platform for rapid assembly of expression vectors for multi-subunit..., Yeast Expression Brigitte Gasser Plasmids to perform CRISPR/Cas9 mediated genome editing in the yeast...

...infect and replicate in. Viral vector The modified form of a wild-type virus used to deliver genetic material...of experiments being performed. Your biosafety office can provide more information on your institution'...they are different viruses and require different isoforms of these packaging components. Therefore, gamma-retroviruses...ccdB-resistant strain is necessary. For more information on cloning and working with plasmids, visit Addgene... the gamma-retroviral genome and the genetic information encoded by that genome. Antibiotic resistance...expanded into a cell line. You can find more information in Addgene’s stable cell line protocol . Addgene... Addgene’s Biosafety Resource Guide for more information and resources on viral safety. Resources and ...

...PSAM is coupled with an ion pore domain (IPD) to form ligand-gated ion channels (LGICs) that can either...

...infect and replicate in. Viral vector The modified form of a wild-type virus used to deliver genetic material...of experiments being performed. Your biosafety office can provide more information on your institution'...they are different viruses and require different isoforms of these packaging components. Therefore, lentivirus...ccdB-resistant strain is necessary. For more information on cloning and working with plasmids, visit Addgene...will have the lentiviral genome and the genetic information encoded by that genome. Antibiotic resistance...GFP and later expanded into a cell line. More information on generating cell lines with lentiviral vectors... Addgene’s Biosafety Resource Guide for more information (including tropism and viral genome percentage...

...your library from Addgene, check the library information to see if it should be amplified before you conduct...in the selection NEGATIVE screen: Apply library Perform Next Generation Sequencing (NGS) on a control sample...library Apply selection; most cells will survive Perform NGS on the surviving cells Compare NGS results ... Company Resources Science Exchange Scientist (formally Assay Depot) Resources Find additional resources...amplification protocol. Read our CRISPR guide for more information on genome-wide screening with CRISPR/Cas9 . Browse...