We narrowed to 17 results for: form
-
TypeGuide...proteins or viral proteins (VP1, VP2 and VP3) that form the icosahedral capsid of the virus. The ITR sequences...Sf9 cells , have also been developed. The newly formed viral particles produced in HEK293T cells are then...molecule that spontaneously reanneals upon infection, forming a double-stranded DNA (dsDNA) template. This eliminates... When these viral vectors co-infect a cell, they form concatemers and splice together, reconstructing ...capsid proteins VP1, VP2, and VP3, which together form the outer capsid shell that protects the viral genome...Recombinant adeno-associated viral (rAAV) vector Modified form of AAV used to deliver genetic material into cells...of experiments being performed. Your biosafety office can provide more information on your institution'...
-
Antibody Guide
TypeGuide...light chains. These four domains come together to form a “Y” shape, as shown in Figure 1. The two arms ...the five human isotypes. Some isotypes naturally form multi-antibody units, while others exist as monomers...may want to identify or collect the protein in any form it may be present in. However, polyclonals can vary...antibody, for each antibody used. Blank controls in the form of sample buffer must also be run. Unique samples...fluorophores. Horseradish peroxidase (HRP) HRP performs a chemiluminescent reaction in the presence of...activated and its output measured. This method can be performed using the indirect detection method via a conjugated... able to recognize the protein in its native conformation. Attachment of the antibody to the beads is ... -
Plan Your Experiment
TypeGuide...potential consequences of having a non-functional form of your protein expressed in your system. HDR : ... to produce the Cas enzyme, and the enzyme then forms a complex with the gRNA for CRISPR activity. Because...purified Cas protein and in vitro transcribed gRNA to form a Cas-gRNA complex. You then delivery the RNP to... and large insertions or deletions. For more information on the wide range of CRISPR technologies, visit...Selecting the genetic manipulation you plan to perform will help you narrow down which components you’...edit, ideally less than 10 bp away. For more information, read our three tips to improve HDR efficiency...your Cas protein and gRNA, which you generally perform by chemical transfection or electroporation. Expression... -
Science Guides
TypeGuide...hort P alindromic R epeat (CRISPR) systems, which form an adaptive immune system in bacteria, have been...genome engineering. Find essential background information on CRISPR and the basics for planning your first... -
Optogenetics Guide
TypeGuide...from Arabidopsis thaliana is fused to truncated forms of cytosolic STIM1 to control calcium channels ~...UVR8 domains UVR8 plant photoreceptor protein that forms photolabile homodimers with slow reversal kinetics...the common actuators used in optogenetics. For information on sensors, check out our Biosensors Plasmid ...blue-shifted channelrhodopsin from Platymonas subcordiformis 445 CoChR Channelrhodopsin from Chloromonas...465 SwiChRca Chloride-conducting channel, Step-waveform inhibitory ChR with mutation C128A (derived from...widely used Cry2-CIB1 system, light induces a conformational change in cryptochrome Cry2 to permit CIB1 ...cryptochromes with light-induced changes in protein conformation/dimerization. In addition to the applications... -
Adenovirus Guide
TypeGuide...consists of two plasmids that eventually recombine to form one: Shuttle/transfer plasmid (e.g. pAdTrack) — ...GFP. Recombinant adenoviral vector (rAdV) Modified form of AdV used to deliver genetic material into cells...of experiments being performed. Your biosafety office can provide more information on your institution'...also made them the most widely used viral vector platform for vaccine design against a diversity of viruses...E1, E4, E2a and VA for replication. For more information about AAVs, read our AAV guide . Recombinant ..., and higher titers. However, the risk of RCA formation is higher for first-generation rAdV vectors than...ccdB-resistant strain is necessary. For more information on cloning and working with plasmids, visit Addgene... -
Molecular Biology Reference
TypeGuide...broadly in their functionality. In their simplest form, plasmids require a bacterial origin of replication...insert. The selectable marker is typically in the form of another antibiotic resistance gene (this time...most commonly used is the Illumina NGS platform. This is the platform used by Addgene’s sequencing partner...molecular biology reference guide, including information on molecular genetics, plasmids, sequencing and...The concept of genes as carriers of phenotypic information was introduced in the early 19th century by Gregor...These daughter cells contain the same genetic information as the parental cell, and are thus termed clones...cloning by restriction enzyme digestion. For more information about restriction enzymes check out NEB's website... -
Sequencing Primers
TypeGuide...primer SFFV-F ATTGATTGACTGCCCACCTC Spleen focus forming virus 5' LTR, forward primer SP6 ATTTAGGTGACACTATAG...available for your convenience. For reference information, please consult Addgene's Molecular Biology Reference... -
CRISPR Guide
TypeGuide...ll express your gRNA and Cas9 protein, which will form a ribonucleoprotein complex through interactions...effector, composed of several separate Cas enzymes that form a complex called Cascade (see Cas3 for more details...with Cas3 Rather than initiating DNA cleavage to form a break, Cas3 initiates single-strand DNA degradation...dCas9 Nuclease dead Cas9, an enzymatically inactive form of Cas9; can bind, but cannot cleave DNA DSB D ouble...Cas9 undergoes a second conformational change upon target binding. In this formation, its nuclease domains...detection platform. Based on this non-specific cleavage, a Cas13a-based molecular detection platform, termed...positively-charged grooves on Cas9. gRNA binding induces a conformational change in Cas9, shifting it into an active,... -
Cloning
TypeGuide...repetitive sequences and DNA that ends in sequences that form complex secondary structues. You can view an example...guide on molecular cloning techniques, including information on seven commonly used cloning methods. Molecular...need for restriction enzyme cloning. For more information and tips check out our Plasmid 101 blog post ...nicks that are repaired by the bacteria after transformation. LIC does not require site-specific recombination... is rendered unnecessary. The product may be transformed directly into E. coli , where the nicks will ...than 10kb. Another advantage is the ability to perform oligonucleotide stitching, in which pieces of DNA...disadvantage is that you need to be set up to grow, transform and purify DNA from yeast. Back to Top... -
Gamma-Retroviral Vector Guide
TypeGuide...infect and replicate in. Viral vector The modified form of a wild-type virus used to deliver genetic material...of experiments being performed. Your biosafety office can provide more information on your institution'...they are different viruses and require different isoforms of these packaging components. Therefore, gamma-retroviruses...ccdB-resistant strain is necessary. For more information on cloning and working with plasmids, visit Addgene... the gamma-retroviral genome and the genetic information encoded by that genome. Antibiotic resistance...expanded into a cell line. You can find more information in Addgene’s stable cell line protocol . Addgene... Addgene’s Biosafety Resource Guide for more information and resources on viral safety. Resources and ... -
Chemogenetics Guide
TypeGuide...PSAM is coupled with an ion pore domain (IPD) to form ligand-gated ion channels (LGICs) that can either... -
Lentiviral Vector Guide
TypeGuide...infect and replicate in. Viral vector The modified form of a wild-type virus used to deliver genetic material...of experiments being performed. Your biosafety office can provide more information on your institution'...they are different viruses and require different isoforms of these packaging components. Therefore, lentivirus...ccdB-resistant strain is necessary. For more information on cloning and working with plasmids, visit Addgene...will have the lentiviral genome and the genetic information encoded by that genome. Antibiotic resistance...GFP and later expanded into a cell line. More information on generating cell lines with lentiviral vectors... Addgene’s Biosafety Resource Guide for more information (including tropism and viral genome percentage... -
Guide to Using Pooled Libraries
TypeGuide...your library from Addgene, check the library information to see if it should be amplified before you conduct...in the selection NEGATIVE screen: Apply library Perform Next Generation Sequencing (NGS) on a control sample...library Apply selection; most cells will survive Perform NGS on the surviving cells Compare NGS results ... Company Resources Science Exchange Scientist (formally Assay Depot) Resources Find additional resources...amplification protocol. Read our CRISPR guide for more information on genome-wide screening with CRISPR/Cas9 . Browse... -
Educational Resources
TypeGuide...Selection What is a Plasmid? Genetic Code Strain Information Molecular Cloning Techniques Protocols Find written...virus, including: Gel Electrophoresis Bacterial Transformation Plasmid Cloning Creating Bacterial Glycerol... -
Addgene's eBook Collection
TypeGuide...find tips for choosing a fluorescent protein; information on FRET, biosensors, and monitoring protein localization... | First Edition About The guide includes information on the many career options in science, advice... -
Promoters
TypeGuide...molecule binds to the repressor, it changes its conformation, preventing its binding to the operator and ...