Skip to main content

We narrowed to 18 results for: form

Showing: 1 - 18 of 18 results
  1. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...proteins or viral proteins (VP1, VP2 and VP3) that form the icosahedral capsid of the virus. The ITR sequences...Sf9 cells , have also been developed. The newly formed viral particles produced in HEK293T cells are then...molecule that spontaneously reanneals upon infection, forming a double-stranded DNA (dsDNA) template. This eliminates... When these viral vectors co-infect a cell, they form concatemers and splice together, reconstructing ...capsid proteins VP1, VP2, and VP3, which together form the outer capsid shell that protects the viral genome...Recombinant adeno-associated viral (rAAV) vector Modified form of AAV used to deliver genetic material into cells...of experiments being performed. Your biosafety office can provide more information on your institution'...
  2. Molecular Biology Reference

    Type
    Guide
    ..., the nucleotides on the opposing strands of DNA form hydrogen bonds, where A always pairs with T, and...broadly in their functionality. In their simplest form, plasmids require a bacterial origin of replication...plasmid. The selectable marker is typically in the form of another antibiotic resistance gene under the ...fluorescence detection, and the sequence outputted in the form of a chromatogram. Sanger can sequence approximately...common is the Illumina NGS platform for short-read sequencing. This is the platform Addgene primarily uses...entire sequence using bioinformatic methods. It is important to note that NGS platforms in general do not ...The concept of genes as carriers of phenotypic information was introduced in the early 19th century by Gregor...
  3. Antibody Guide

    Type
    Guide
    ...light chains. These four domains come together to form a “Y” shape, as shown in Figure 1. The two arms ...the five human isotypes. Some isotypes naturally form multi-antibody units, while others exist as monomers...may want to identify or collect the protein in any form it may be present in. However, polyclonals can vary...antibody, for each antibody used. Blank controls in the form of sample buffer must also be run. Unique samples...fluorophores. Horseradish peroxidase (HRP) HRP performs a chemiluminescent reaction in the presence of...activated and its output measured. This method can be performed using the indirect detection method via a conjugated... able to recognize the protein in its native conformation. Attachment of the antibody to the beads is ...
  4. Plan Your Experiment

    Type
    Guide
    ...potential consequences of having a non-functional form of your protein expressed in your system. HDR : ... to produce the Cas enzyme, and the enzyme then forms a complex with the gRNA for CRISPR activity. Because...purified Cas protein and in vitro transcribed gRNA to form a Cas-gRNA complex. You then delivery the RNP to... and large insertions or deletions. For more information on the wide range of CRISPR technologies, visit...Selecting the genetic manipulation you plan to perform will help you narrow down which components you’...edit, ideally less than 10 bp away. For more information, read our three tips to improve HDR efficiency...your Cas protein and gRNA, which you generally perform by chemical transfection or electroporation. Expression...
  5. Science Guides

    Type
    Guide
    ...hort P alindromic R epeat (CRISPR) systems, which form an adaptive immune system in bacteria, have been...genome engineering. Find essential background information on CRISPR and the basics for planning your first...
  6. Adenovirus Guide

    Type
    Guide
    ...consists of two plasmids that eventually recombine to form one: Shuttle/transfer plasmid (e.g. pAdTrack) — ...GFP. Recombinant adenoviral vector (rAdV) Modified form of AdV used to deliver genetic material into cells...of experiments being performed. Your biosafety office can provide more information on your institution'...also made them the most widely used viral vector platform for vaccine design against a diversity of viruses...E1, E4, E2a and VA for replication. For more information about AAVs, read our AAV guide . Recombinant ..., and higher titers. However, the risk of RCA formation is higher for first-generation rAdV vectors than...ccdB-resistant strain is necessary. For more information on cloning and working with plasmids, visit Addgene...
  7. Optogenetics Guide

    Type
    Guide
    ...excitation λ (nm) UVR8 Plant photoreceptor protein that forms photolabile homodimers with slow reversal kinetics... of CRY2 from A. thaliana is fused to truncated forms of cytosolic STIM1 to control calcium channels ~.... Optical switches harness light-responsive conformational changes in natural light-sensing domains to...blue-shifted channelrhodopsin from Platymonas subcordiformis 445 CoChR Channelrhodopsin from Chloromonas...increased photocurrent amplitude 465 SwiChR Step-waveform inhibitory ChR, chloride channel derived from ...helix-loop-helix CIB1. Blue light induces a conformational change in Cry2 that allows CIB1 binding, which...domains undergo light-induced changes in protein conformation, controlling activity of a fused protein through...
  8. Sequencing Primers

    Type
    Guide
    ...Forward SFFV-F ATTGATTGACTGCCCACCTC Spleen focus forming virus 5' LTR Forward SP6 ATTTAGGTGACACTATAG SP6...Email us at [email protected] . For additional information on molecular biology, plasmids, and recombinant...
  9. CRISPR Guide

    Type
    Guide
    ...ll express your gRNA and Cas9 protein, which will form a ribonucleoprotein complex through interactions...effector, composed of several separate Cas enzymes that form a complex called Cascade (see Cas3 for more details...with Cas3 Rather than initiating DNA cleavage to form a break, Cas3 initiates single-strand DNA degradation...dCas9 Nuclease dead Cas9, an enzymatically inactive form of Cas9; can bind, but cannot cleave DNA DSB D ouble...Cas9 undergoes a second conformational change upon target binding. In this formation, its nuclease domains...detection platform. Based on this non-specific cleavage, a Cas13a-based molecular detection platform, termed...positively-charged grooves on Cas9. gRNA binding induces a conformational change in Cas9, shifting it into an active,...
  10. Molecular Cloning Techniques

    Type
    Guide
    ...repetitive sequences and DNA that ends in sequences that form complex secondary structures. Read more in our SLIC... with four nicks that bacteria repair after transformation. LIC does not require site-specific recombination... is rendered unnecessary. The product may be transformed directly into E. coli , where the normal replication... recombination abilities of yeast. By simply transforming into yeast two (or more) fragments of dsDNA ...than 10 kb. Another advantage is the ability to perform oligonucleotide stitching, in which pieces of DNA... seamless manner. To accomplish this, you can transform into yeast the fragments of DNA to be fused along...
  11. Modular Cloning Guide

    Type
    Guide
    ...modules can be assembled into a Level 2 vector, forming a functional genetic circuit. Level 2 vectors are...E. coli to maintain the final plasmid after transformation. Figure 1: Overview of the MoClo Toolkit components...multigene constructs. MoClo Plant Parts III: Transformation & Genome Engineering Kit Plant Expression, ...plasmids with multi-gene constructs for plant transformation. GoldenBraid 2.0 Kit Plant Expression, CRISPR...Daniel Voytas 76 plasmids for assembling plant transformation vectors for overexpression, gene editing, functional...Expression, Mammalian Expression Stephan Gruber Platform for rapid assembly of expression vectors for multi-subunit..., Yeast Expression Brigitte Gasser Plasmids to perform CRISPR/Cas9 mediated genome editing in the yeast...
  12. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...infect and replicate in. Viral vector The modified form of a wild-type virus used to deliver genetic material...of experiments being performed. Your biosafety office can provide more information on your institution'...they are different viruses and require different isoforms of these packaging components. Therefore, gamma-retroviruses...ccdB-resistant strain is necessary. For more information on cloning and working with plasmids, visit Addgene... the gamma-retroviral genome and the genetic information encoded by that genome. Antibiotic resistance...expanded into a cell line. You can find more information in Addgene’s stable cell line protocol . Addgene... Addgene’s Biosafety Resource Guide for more information and resources on viral safety. Resources and ...
  13. Chemogenetics Guide

    Type
    Guide
    ...PSAM is coupled with an ion pore domain (IPD) to form ligand-gated ion channels (LGICs) that can either...
  14. Lentiviral Vector Guide

    Type
    Guide
    ...infect and replicate in. Viral vector The modified form of a wild-type virus used to deliver genetic material...of experiments being performed. Your biosafety office can provide more information on your institution'...they are different viruses and require different isoforms of these packaging components. Therefore, lentivirus...ccdB-resistant strain is necessary. For more information on cloning and working with plasmids, visit Addgene...will have the lentiviral genome and the genetic information encoded by that genome. Antibiotic resistance...GFP and later expanded into a cell line. More information on generating cell lines with lentiviral vectors... Addgene’s Biosafety Resource Guide for more information (including tropism and viral genome percentage...
  15. Guide to Using Pooled Libraries

    Type
    Guide
    ...biological perturbation Limitations No functional information on genes unless combined with perturbations Requires...genetic material. Commonly used surface display platforms include: Phage Display: In this system, a peptide...cerevisiae , often by fusion to the Aga2p protein. This platform supports the correct folding and post-translational..., but they do not contain as much regulatory information. To make a cDNA library, cDNA is synthesized,...functional complementation. Advantages Strong and uniform overexpression Independent of chromatin accessibility...Non-physiological expression Cannot capture regulatory/isoform complexity shRNA/RNAi shRNA libraries permit reversible...your library from Addgene, check the library information to see if it should be amplified before you conduct...
  16. Educational Resources

    Type
    Guide
    ...Selection What is a Plasmid? Genetic Code Strain Information Molecular Cloning Techniques Protocols Find written...virus, including: Gel Electrophoresis Bacterial Transformation Plasmid Cloning Creating Bacterial Glycerol...
  17. Addgene's eBook Collection

    Type
    Guide
    ...find tips for choosing a fluorescent protein; information on FRET, biosensors, and monitoring protein localization... | First Edition About The guide includes information on the many career options in science, advice...
  18. Promoters

    Type
    Guide
    ...molecule binds to the repressor, it changes its conformation, preventing its binding to the operator and ...
Showing: 1 - 18 of 18 results