Skip to main content
Addgene
Showing: 1 - 17 of 17 results
  1. Antibody Guide

    Type
    Guide
    ...light chains. These four domains come together to form a “Y” shape, as shown in Figure 1. The two arms ...the five human isotypes. Some isotypes naturally form multi-antibody units, while others exist as monomers...may want to identify or collect the protein in any form it may be present in. However, polyclonals can vary...antibody, for each antibody used. Blank controls in the form of sample buffer must also be run. Unique samples...fluorophores. Horseradish peroxidase (HRP) HRP performs a chemiluminescent reaction in the presence of...activated and its output measured. This method can be performed using the indirect detection method via a conjugated... able to recognize the protein in its native conformation. Attachment of the antibody to the beads is ...
  2. Science Guides

    Type
    Guide
    ...hort P alindromic R epeat (CRISPR) systems, which form an adaptive immune system in bacteria, have been...genome engineering. Find essential background information on CRISPR and the basics for planning your first...
  3. Optogenetics Guide

    Type
    Guide
    ...from Arabidopsis thaliana is fused to truncated forms of cytosolic STIM1 to control calcium channels ~...UVR8 domains UVR8 plant photoreceptor protein that forms photolabile homodimers with slow reversal kinetics...the common actuators used in optogenetics. For information on sensors, check out our Biosensors Plasmid ...blue-shifted channelrhodopsin from Platymonas subcordiformis 445 CoChR Channelrhodopsin from Chloromonas...465 SwiChRca Chloride-conducting channel, Step-waveform inhibitory ChR with mutation C128A (derived from...widely used Cry2-CIB1 system, light induces a conformational change in cryptochrome Cry2 to permit CIB1 ...cryptochromes with light-induced changes in protein conformation/dimerization. In addition to the applications...
  4. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...acceptor. When these viruses co-infect a cell they form concatemers, are spliced together, and the full-... to be packaged in AAVs. Click here for more information on optogenetics plasmids available from Addgene...forward for in vivo genome editing. For more information on AAV-CRISPR, please see this blog post. Browse...
  5. Molecular Biology Reference

    Type
    Guide
    ...broadly in their functionality. In their simplest form, plasmids require a bacterial origin of replication...insert. The selectable marker is typically in the form of another antibiotic resistance gene (this time...most commonly used is the Illumina NGS platform. This is the platform used by Addgene’s sequencing partner...molecular biology reference guide, including information on molecular genetics, plasmids, sequencing and...The concept of genes as carriers of phenotypic information was introduced in the early 19th century by Gregor...These daughter cells contain the same genetic information as the parental cell, and are thus termed clones...cloning by restriction enzyme digestion. For more information about restriction enzymes check out NEB's website...
  6. Sequencing Primers

    Type
    Guide
    ...primer SFFV-F ATTGATTGACTGCCCACCTC Spleen focus forming virus 5' LTR, forward primer SP6 ATTTAGGTGACACTATAG...available for your convenience. For reference information, please consult Addgene's Molecular Biology Reference...
  7. Cloning

    Type
    Guide
    ...repetitive sequences and DNA that ends in sequences that form complex secondary structues. You can view an example...guide on molecular cloning techniques, including information on seven commonly used cloning methods. Molecular...need for restriction enzyme cloning. For more information and tips check out our Plasmid 101 blog post ...nicks that are repaired by the bacteria after transformation. LIC does not require site-specific recombination... is rendered unnecessary. The product may be transformed directly into E. coli , where the nicks will ...than 10kb. Another advantage is the ability to perform oligonucleotide stitching, in which pieces of DNA...disadvantage is that you need to be set up to grow, transform and purify DNA from yeast. Back to Top...
  8. Plan Your Experiment

    Type
    Guide
    ...protein and in vitro transcribed gRNA are combined to form a Cas9-gRNA complex, which is delivered to cells... be used to examine off-target effects. More information on each of these techniques can be found in our...
  9. CRISPR Guide

    Type
    Guide
    ...ll express your gRNA and Cas9 protein, which will form a ribonucleoprotein complex through interactions...effector, composed of several separate Cas enzymes that form a complex called Cascade (see Cas3 for more details...with Cas3 Rather than initiating DNA cleavage to form a break, Cas3 initiates single-strand DNA degradation...dCas9 Nuclease dead Cas9, an enzymatically inactive form of Cas9; can bind, but cannot cleave DNA DSB D ouble...Cas9 undergoes a second conformational change upon target binding. In this formation, its nuclease domains...detection platform. Based on this non-specific cleavage, a Cas13a-based molecular detection platform, termed...positively-charged grooves on Cas9. gRNA binding induces a conformational change in Cas9, shifting it into an active,...
  10. Chemogenetics Guide

    Type
    Guide
    ...PSAM is coupled with an ion pore domain (IPD) to form ligand-gated ion channels (LGICs) that can either...
  11. Lentiviral Guide

    Type
    Guide
    ...experiments being performed, and your biosafety office can provide more information on your institution's...plasmids utilize a hybrid LTR promoter (more information on this below). Additional or specialized promoters...different viruses and thus use slightly different isoforms of these packaging components. Therefore, lentivirus... a range of species and cell types. For more information, see the Cronin, et al. article on different ...the lentiviral genome and harbor the genetic information encoded by that genome. Many lentiviral transfer...generate more useful restriction sites. For more information about cloning and changing a MCS, visit Addgene's...recombine. Visit Invitrogen's website for more information on the Gateway® cloning system. What safety concerns...
  12. Adenovirus Guide

    Type
    Guide
    ...plasmid. Please see our Biosafety guide for more information on working with adenovirus. Overview of Adenoviral...restriction enzyme PmeI. This construct is then transformed into AdEasier-1 cells , which are BJ5183 E. coli... into the adenoviral plasmid. One can also co-transform standard BJ5183 with supercoiled pAdEasy™ and ...E1, E4, E2a and VA for replication. For more information about AAV, read our AAV guide . Can I make a ...each round of amplification. Where can I find information about using the AdEasy™ System? The laboratory...
  13. Guide to Using Pooled Libraries

    Type
    Guide
    ...your library from Addgene, check the library information to see if it should be amplified before you conduct...in the selection NEGATIVE screen: Apply library Perform Next Generation Sequencing (NGS) on a control sample...library Apply selection; most cells will survive Perform NGS on the surviving cells Compare NGS results ... Company Resources Science Exchange Scientist (formally Assay Depot) Resources Find additional resources...amplification protocol. Read our CRISPR guide for more information on genome-wide screening with CRISPR/Cas9 . Browse...
  14. Retrovirus Guide

    Type
    Guide
    ...products for packaging (i.e., Gag, Pol, and Env), the isoforms of these proteins, as well as the viral LTRs, ... Addgene . Please see our Biosafety page for information on working with retrovirus. Packaging using 293T...different viruses and thus use slightly different isoforms of these packaging components. Therefore, lentiviruses...plasmids may be used interchangeably. For more information about lentivirus, please read our lentivirus ...
  15. Educational Resources

    Type
    Guide
    ...Selection What is a Plasmid? Genetic Code Strain Information Molecular Cloning Techniques Protocols Find written...virus, including: Gel Electrophoresis Bacterial Transformation Plasmid Cloning Creating Bacterial Glycerol...
  16. Addgene's eBook Collection

    Type
    Guide
    ...find tips for choosing a fluorescent protein; information on FRET, biosensors, and monitoring protein localization... | First Edition About The guide includes information on the many career options in science, advice...
  17. Promoters

    Type
    Guide
    ...molecule binds to the repressor, it changes its conformation, preventing its binding to the operator and ...
Showing: 1 - 17 of 17 results