We narrowed to 969 results for: ARC;

...MoClo Plasmid Kits Available from Addgene Browse or search the table below to find MoClo kits in our collection...Johannes Stuttmann 95 additional plasmids for hierarchical assembly of plant multigene constructs. MoClo...characterized parts that can be used for bottom-up hierarchical assembly of single and multi-gene constructs...species. Ubigate Collection Bacterial Expression Marco Trujillo Plasmids for reconstituting the ubiquitination...

...constant regions of other antibodies. This has useful research applications, and is covered in the following ...conjugating reactions are possible. It is important to research your reaction and buffer before conjugating your...powerful, but in order to utilize it in the lab, researchers must be able to detect if and where an antibody...antibodies validated for a similar assay type) and search again. After filtering, narrow down further by ...

...DNA, is an essential process used in scientific research and discovery. With molecular cloning, scientists... on choosing the right cloning method for your research project . This guide highlights several of the...are naturally produced by certain bacteria and archaea, cleave double-stranded DNA (dsDNA) at specific...

...range of topics in molecular biology, laboratory research, and career development. eBooks Download any of... enzymes to assist with your molecular biology research. Topics include: Antibiotic Concentrations for...

...tools and technologies developed for optogenetics research utilize light to detect, measure, and control ...different types of viruses that are commonly used in research, including: Lentivirus Adeno-associated Virus ...

...sequences targeting each gene in the overall library. Barcoding libraries contain plasmids with unique, semi-random...positive and negative) is the responsibility of the researcher. Created with BioRender.com. Both positive and...

...with BioRender.com. Common Bacterial Promoters Researchers often incorporate the following promoters into...regulatory elements. Common Eukaryotic Promoters Researchers often incorporate the following promoters into...

... Forward pREP Forward GCTCGATACAATAAACGCC Rous sarcoma virus (RSV) promoter Forward pRS-marker CGGCATCAGAGCAGATTGTA...Reverse RCAS-F ACATGGGTGGTGGTATAGCGCTTGCG 3' of Rous sarcoma virus (RSV) env gene Forward Rluc-F CCAGGATTCTTTTCCAATGC...

...Sternson SM (2019). Ultrapotent chemogenetics for research and potential clinical applications. Science, ...