Skip to main content

We narrowed to 17 results for: ARC;

Showing: 1 - 17 of 17 results
  1. Optogenetics Guide

    Type
    Guide
    ...inhibiting function of the neuron. Archaerhodopsins Archaerhodopsin-3 (Arch) from Halorubrum sodomense and...TP009; improved light sensitivity over Arch 566 eArchT 3.0 ArchT with addition of trafficking signal from...membrane targeting 589 Archaerhodopsins Name Description Peak excitation λ (nm) Arch Light-activated outward...outward proton pump from Halorubrum sodomense 566 eArch 3.0 Arch with addition of trafficking signal from Kir2.1...nonspecific cation influx vs. proton efflux. Researchers have used genetic engineering to improve these...have been instrumental in neurological disorder research, helping scientists to better understand Parkinson's...used to inhibit neurons in optogenetic experiments. Arch is a light-activated outward proton pump that hyperpolarizes...
  2. CRISPR Guide

    Type
    Guide
    ... help you get started using CRISPR in your own research. CRISPR Basics In this section, we will introduce...same chromosome. Most multiplex systems enable researchers to target anywhere from 2–7 genetic loci by cloning...Overview of Cas9n. Increasing fidelity of Cas9 Researchers have also enhanced specificity by engineering... overcome the CRISPR systems that bacteria and archaea use to protect against these foreign nucleic acids...Base Editing To overcome low HDR efficiency, researchers have developed base editors to specifically convert... 5: Overview of base editing. More recently, researchers have developed base editors that can catalyze...Base Edit CRISPR Prime Editing Prime editing is a “search and replace” gene editing method in which Moloney...
  3. Guide to Using Pooled Libraries

    Type
    Guide
    ... a single tube. Types of Pooled Libraries Barcoding Barcode libraries contain large numbers of plasmids...nucleotide sequence, or barcode, used to mark individual cells. These barcodes will then be inherited ...any daughter cells, making barcode libraries ideal for lineage tracing. Barcode libraries can be used for...design additional hypothesis-directed experiments. Barcoding libraries contain plasmids with unique, semi-random...designed for other specific purposes, such as barcoding or targeting RNA. Advantages Strong, specific ...shRNAs that target it. shRNA libraries may also be barcoded to allow for easy identification of the shRNA ...positive and negative) is the responsibility of the researcher. Created with BioRender.com. Both positive and...
  4. Lentiviral Vector Guide

    Type
    Guide
    ...conducting cellular barcoding experiments. Lentiviral vectors allow for integration of the barcodes, which can ...treatments into cells, and has been widely used in the research community for decades. Wild-type lentiviruses ...vectors have many aspects that make them useful research tools in a variety of cell types and models. Lentiviral... of a transgene, lentiviral vectors are useful research and clinical tools. Stable Cell Lines Lentiviral...Addgene's collection of CRISPR libraries . Cellular Barcoding Much like genomic screens, lentiviral vectors ...inherited by daughter cells. Inheritance of the barcodes makes lentiviral libraries popular for lineage...heterogeneous tumors. Browse Addgene's collection of barcoding libraries . Mouse Modeling Since the development...
  5. Adenovirus Guide

    Type
    Guide
    ...Wild-type adenoviruses have been modified by researchers to create recombinant adenoviral (rAdV) vectors...gene expression patterns that were observed, researchers have tended to favor using first- and third-generation...is still the most commonly used generation for research purposes. The system consists of two plasmids ...in combination with foreign capsid proteins. Researchers have further refined the tropism of rAdV vectors...vectors are often the preferred choice among researchers due to their reduced immunogenicity and longer...transgene expression, rAdV vectors are used in many research fields, especially when needing transgenes to ... and can trigger a strong immune response to researchers if exposed. There is a risk of spontaneous reversion...
  6. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...Vectors Wild-type AAVs have been modified by researchers to create recombinant adeno-associated viral ...in combination with foreign capsid proteins. Researchers have further refined the tropism of rAAV vectors...diffused biological structures. Specifically, researchers were interested in creating systemic capsids ...send information to a given region. This allows researchers to trace connections between neurons, map the...make them ideal for gene therapy, neuroscience research, and other biomedical fields. Gene Therapy One... opsins and other optical tools developed by researchers are used to detect, measure, and control molecular...institution's best practices with regard to AAV-related research. See Addgene’s Biosafety Resource Guide for more...
  7. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...types include murine leukemia virus (MLV), murine sarcoma virus (MSV), and feline leukemia virus (FeLV). ...treatments into cells, and has been widely used in the research community for decades. Wildtype gamma-retroviruses...vectors have many aspects that make them useful research tools in a variety of cell types and models, such...integration, gamma-retroviral vectors are useful research and clinical tools thanks to their long-term expression...practices with regard to gamma-retroviral-related research. See Addgene’s Biosafety Resource Guide for more...Retroviral Vectors and Their Uses in Scientific Research Gamma-retroviral Packaging Systems The Retroviral... enhancers and active promoters. Nucleic Acids Research , 42 (7), 4257–4269. https://doi.org/10.1093/nar...
  8. Plan Your Experiment

    Type
    Guide
    ...enables researchers to manipulate the genome with relative ease. Over the past decade, researchers have ...are many different Cas proteins available, and researchers can adapt these experiments for different organisms...framework to get you started using CRISPR in your research and setting up CRISPR experiments. We will focus...proceeding, we recommend asking labmates/colleagues, searching the literature, or discussing with your PI to ...
  9. Molecular Biology Reference

    Type
    Guide
    ...codon-amino acid pairs. Over the past two decades, researchers have also expanded the genetic code by redirecting...chromosomal DNA. Although they can be found in archaea and eukaryotes, they play the most significant ...phoA supE44 thi-1 gyrA96 relA1 tonA EPI300 LGC Biosearch Technologies; MilliporeSigma F- mcrA Δ(mrr-hsdRMS-mcrBC...fragmented into small pieces, labeled with a short DNA barcode, and amplified. These DNA fragments are attached...information to aid in the reproducibility of scientific research. Long-read Sequencing Sanger sequencing and Illumina...
  10. Modular Cloning Guide

    Type
    Guide
    ...MoClo Plasmid Kits Available from Addgene Browse or search the table below to find MoClo kits in our collection...Johannes Stuttmann 95 additional plasmids for hierarchical assembly of plant multigene constructs. MoClo...characterized parts that can be used for bottom-up hierarchical assembly of single and multi-gene constructs...species. Ubigate Collection Bacterial Expression Marco Trujillo Plasmids for reconstituting the ubiquitination...
  11. Antibody Guide

    Type
    Guide
    ...constant regions of other antibodies. This has useful research applications, and is covered in the following ...conjugating reactions are possible. It is important to research your reaction and buffer before conjugating your...powerful, but in order to utilize it in the lab, researchers must be able to detect if and where an antibody...antibodies validated for a similar assay type) and search again. After filtering, narrow down further by ...
  12. Molecular Cloning Techniques

    Type
    Guide
    ...DNA, is an essential process used in scientific research and discovery. With molecular cloning, scientists... on choosing the right cloning method for your research project . This guide highlights several of the...are naturally produced by certain bacteria and archaea, cleave double-stranded DNA (dsDNA) at specific...
  13. Educational Resources

    Type
    Guide
    ...range of topics in molecular biology, laboratory research, and career development. eBooks Download any of... enzymes to assist with your molecular biology research. Topics include: Antibiotic Concentrations for...
  14. Science Guides

    Type
    Guide
    ...tools and technologies developed for optogenetics research utilize light to detect, measure, and control ...different types of viruses that are commonly used in research, including: Lentivirus Adeno-associated Virus ...
  15. Promoters

    Type
    Guide
    ...with BioRender.com. Common Bacterial Promoters Researchers often incorporate the following promoters into...regulatory elements. Common Eukaryotic Promoters Researchers often incorporate the following promoters into...
  16. Sequencing Primers

    Type
    Guide
    ... Forward pREP Forward GCTCGATACAATAAACGCC Rous sarcoma virus (RSV) promoter Forward pRS-marker CGGCATCAGAGCAGATTGTA...Reverse RCAS-F ACATGGGTGGTGGTATAGCGCTTGCG 3' of Rous sarcoma virus (RSV) env gene Forward Rluc-F CCAGGATTCTTTTCCAATGC...
  17. Chemogenetics Guide

    Type
    Guide
    ...Sternson SM (2019). Ultrapotent chemogenetics for research and potential clinical applications. Science, ...Addgene. Last Updated Content last reviewed on 4 March 2026....
Showing: 1 - 17 of 17 results