Skip to main content

We narrowed to 99 results for: 3-Oct

Showing: 81 - 99 of 99 results
  1. Negotiating Work and Life: How to Find the Joy

    Type
    Blog Post
    ...100th birthday, as your mom will never forgive you… #3 Honor the work day and keep it holy Keep a regular...And, yes, your partner CAN take the kids to the doctor without your help. Your partner is equally responsible...eight-year-old daughter vehemently reminded her doctor that she was allergic to penicillin – I am much...
  2. Four Factors that Differentiate the Stem Cell Field

    Type
    Blog Post
    ... scientists have certainly not lost site of that. 3. Stem cell science is hard, and expensive Dr. Yamanaka...differentiated cells simply by expressing four proteins Oct4, Sox2, Klf4, and cMyc (the so called OSKM factors...
  3. 5 Great Apps for Lab Life

    Type
    Blog Post
    ...great tool for someone starting cell culture work. 3. NEB Tools by New England BioLabs In my lab we do ...Management Software Resources on Addgene.org Find Protoctols for Your Research Catch Up On Your Molecular ...
  4. AAV Production in HEK293 Cells

    Type
    Protocol
    ...0: Seed cells in CS2 Day 2: Seed cells in CS5 Day 3 (am): Transfect cells Day 7 (am): Harvest cells Equipment...interest Triton X-100 Benzonase/DNAse I (Millipore 71205-3) 40% Polyethylene Glycol 8000 (PEG) + 0.5 M NaCl Cell... PBS and add 35 mL of 0.05% Trypsin/EDTA. Wait ~2-3 minutes for cells to detach. Gently tap the sides ...stir slowly at 4 °C for 1 h, then keep at 4 °C for 3 h without stirring to allow full precipitation. Precipitation... at 4 °C if needed. Transfer the entire sample to 3 x 500 mL conical bottles and centrifuge at 3900 rpm...before these images were taken. Last reviewed on: October 10, 2023...
  5. Viral Vectors 101: Systemic Capsids

    Type
    Blog Post
    ...while AAV-PHP.S is typically used at a dose between 3 x 1011 and 1 x 1012 vg*. Most systemic capsids are...transduction in New World monkeys   Figure 3: Evolutionary tree depicting the phylogenetic relationship...414 (2019). https://doi.org/10.1038/s41596-018-0097-3 More resources on the Addgene blog Viral Vectors 101...Sensory Ganglion Neurons Using AAV-PHP.S. eNeuro,9(3), ENEURO.0373-21.2022. https://doi.org/10.1523/ENEURO...Are Limited to C57BL/6J Mice. Molecular Therapy, 26(3), 664–668. https://doi.org/10.1016/j.ymthe.2018.01.018.... R., Flytzanis, N. C., Goeden, N., Christopher Octeau, J., Roxas, K. M., Chan, K. Y., Scherrer, J., Winchester...
  6. Transferable Skills Guide: Career Planning Resources

    Type
    Blog Post
    ...www.businessinsider.com/how-to-get-the-most-out-of-job-fairs-2014-3 https://www.forbes.com/sites/neilpatel/2015/05/21/... students today is that many graduate and post-doctoral programs lack any formal or mandatory professional...
  7. Antibiotic Resistance: An Old Solution but a New Problem

    Type
    Blog Post
    ...Government (2016). 2. CDC Information Pages on Antibiotics 3. WHO Antimicrobial Resistance Fact Sheet  Additional...www.youtube.com/watch?v=sx1uDYSfINA. When you go to the doctor, it will very likely take time to determine if ...
  8. Troubleshooting and Optimizing a Western Blot

    Type
    Blog Post
    ...the membrane is cut so each lane is its own piece (3). After incubation, blocking, and washing, the membrane...protein concentration decreases).     Figure 3: Testing the antibody’s dynamic range. A) The protein...resources with examples, like BioRad’s Western Blot Doctor page, or robust discussions, like ResearchGate’...
  9. Antibody Validation Using the Indirect ELISA Method

    Type
    Protocol
    ...Timeline Day 1: Antigen Coating Day 2: Blocking Day 3: Primary antibody incubation Day 4: Secondary antibody...at room temperature or overnight at 4 °C . Section 3: Primary antibody incubation Carefully remove the ...micrograms of antigen loaded. Last reviewed on: October 8, 2024...
  10. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ...or 1kb fragments are produced (see figure above). 3 Reasons The PSU Ladders Are Awesome Tools: They are... through the expression of transcription factors OCT3/4, SOX2, KLF4, and c-MYC is the established model...Addgene and include a variety of cMYC, KLF4, SOX2 and OCT4 DNA binding domain and transcription activation ...
  11. Deep Dive: qPCR

    Type
    Blog Post
    ...should be ~60°C (between 50 and 65, with no more than 3 degrees between the two Tms)  Aim for 50-60% GC content...Nucleic Acids Research, Volume 28, Issue 19, 1 October 2000, Pages 3752–3761, https://doi.org/10.1093/...
  12. Sequencing Primers

    Type
    Guide
    ...ATGGCTCATAACACCCCTTG 3' of attL2 in pENTR vector/td> Reverse pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' of MCS in pGEX... For pBluescript vector Reverse pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' end of MCS in pGEX vectors Reverse ...Sequencing Primers Name Sequence (5' to 3') Description Direction 3'AOX1 GCAAATGGCATTCTGACATCC For Pichia...GAGTAGTAACAAAGGTCAA 3' end of Gal4 DNA binding domain Forward Gal4-AD AATACCACTACAATGGAT 3' end of Gal4 activation...S. cerevisiae GPD promoter Forward GW-3' GCATGATGACCACCGATATG 3' end of Gateway cassette Forward GW-5'...GATGAAGCCCTGAAAGACGCGCAG 3' end of maltose binding protein Forward mCherry-F CCCCGTAATGCAGAAGAAGA 3' end of mCherry... pAd-CMV vector Forward pBABE 3' ACCCTAACTGACACACATTCC SV40 enhancer, 3' of MCS in pBABE vectors Reverse...
  13. Molecular Cloning Techniques

    Type
    Guide
    ... interest into fragments containing precise 5' or 3' single-strand overhangs (sticky ends), or no overhang...Gateway attB1 and attB2 sites attached to the 5’ and 3’ ends of the DNA sequence. This fragment can then ...which naturally leaves a single A overhang on the 3' end of PCR products. The complementary T comes from...covalently bound to the phosphate group on the free 3' T. The topoisomerase acts as a ligase that joins ... Read more in our TOPO Cloning blog post . Figure 3: Summary of TOPO cloning. TOPO = topoisomerase I. ... Ligation Independent Cloning (LIC) relies on the 3' to 5' exonuclease activity of T4 DNA polymerase. ...Plasmids cloning topics Content last reviewed: 22 October 2025...
  14. Promoters

    Type
    Guide
    ...example of a negatively-controlled operon (Figure 3). A positive-repressible operon works in the opposite...example of a positively-controlled operon. Figure 3: Lac operon regulation. Created with BioRender.com...proteins) make up the transcription complex. The most 3' portion (closest to the gene's start codon) of the...Constitutive Yeast Very strong promoter from glyceraldehyde 3-phosphage dehydrogenase; also called TDH3 or GAPDH... Plasmids 101 topics Content last reviewed: 22 October 2025...
  15. Optogenetics Guide

    Type
    Guide
    ...function of the neuron. Archaerhodopsins Archaerhodopsin-3 (Arch) from Halorubrum sodomense and its variants ...reversible dimerization of Phytochrome Interacting Factor 3 or 6 (PIF3 or PIF6) with PhyB 660 PhyA/FYH1 and PhyA...chemical-genetic control of neurons. PLoS ONE, 8 (3), e59759. https://doi.org/10.1371/journal.pone.0059759...: A Retrospective and a Look Ahead. Adv Genet, 6 (3), e00021. https://doi.org/10.1002/ggn2.202500021 PMID...with single-spike temporal resolution. PLoS ONE, 2 (3), e299. https://doi.org/10.1371/journal.pone.0000299... of distinct neural populations. Nat Methods, 11 (3), 338–346. https://doi.org/10.1038/nmeth.2836 PMID...of neural activity. Cold Spring Harb Protoc, 2011 (3), top102. https://doi.org/10.1101/pdb.top102 PMID:...
  16. Molecular Biology Reference

    Type
    Guide
    ...chain-termination sequencing or dideoxy sequencing (Figure 3). Sanger sequencing relies on the random incorporation... efficient and reliable sequencing method. Figure 3: Summary of Sanger sequencing. Created with BioRender.com.... Uracil replaces thymine in RNA molecules. Every 3 nucleotides (codons) in a DNA sequence encodes for...blog Addgene Protocols Content last reviewed: 22 October 2025...
Showing: 81 - 99 of 99 results