Skip to main content

We narrowed to 858 results for: HA

Showing: 81 - 100 of 858 results
  1. Virus Protocol - Generating Stable Cell Lines

    Type
    Protocol
    ...polyclonal cell population, meaning that the transgene has integrated in different locations in the various ...variety of dilutions and pick the population that has the most desirable level of expression. Over time...
  2. What is Polymerase Chain Reaction (PCR)

    Type
    Protocol
    ...Extend DNA for 1 minute at 72°C: The Taq polymerase has an optimal temperature around 70-75°C so this step...changes during a typical PCR. The DNA polymerase has an optimum temperature around 70°C and is the molecule...
  3. Transfection for Recombinant Antibodies

    Type
    Protocol
    ...final volume of 1 L and recheck pH to ensure that it has not drifted. Filter the solution through a 0.22 µm...incubate for 1 h at room temperature. After the BCD TFX has warmed in the bead bath, transfer the tubes to the...
  4. Protocol - How to Design Primers

    Type
    Protocol
    ...the 3’ end, and the 5’ end of the primer usually has stretches of several nucleotides. Also, both of the...
  5. Sequencing Primers

    Type
    Guide
    ...forward primer HA-F TACCCATACGACGTCCCAGA HA tag, forward primer HA-R TCTGGGACGTCGTATGGGTA HA tag, reverse...Reference Sequencing Primers Sequencing Primers Addgene has used a number of primers for sanger sequence verification...
  6. Chemogenetics Guide

    Type
    Guide
    ...studies, however, it has off-target effects. The atypical antipsychotic drug olanzapine has also been shown...is based on the human M3 muscarinic receptor and has not been used in vivo . Figure 2: DREADDs, their ...for muscarinic-receptor based DREADDs. Compound 21 has similar potency as CNO, while DCZ is more potent ...attractive alternatives for experiments. Perlapine has been previously used in human populations in Japan...luciferase-fluorescent protein fusions, to more-sensitive opsins has led to improved LMOs with increased efficiencies....
  7. HA Frankenbody, a New Imaging Tool to Visualize Single Molecules and Nascent Peptides

    Type
    Blog Post
    ... the HA frankenbody? Another large advantage of the HA frankenbody is that it remains bound to HA epitopes...feature provides HA frankenbody the ability to bind nascent HA tagged proteins.  Lastly, the HA frankenbody...the widely used HA epitope in diverse cellular environments. They called this probe the HA frankenbody (... towards a HA epitope from the CDRs.  To visualize proteins of interest tagged with the HA epitope, the...spaghetti monster HA (smHA) which contains a 10xHA tag. These experiments demonstrated that the HA frankenbody...localization of single HA-tagged molecules over time.  The Stasevich lab also proved that HA frankenbody can ...proteins.  Limitations with GFP in imaging  While GFP has been an immensely powerful tool to study proteins...
  8. CRISPR Guide

    Type
    Guide
    .... Cas9 nickase (Cas9n), a D10A mutant of SpCas9, has one active nuclease domain and one inactivated one... available. SaCas9 (from Staphylococcus aureus ) has a coding sequence ~1 kb shorter than SpCas9 while... SpCas9. FrCas9 (from Faecalibaculum rodentium ) has increased fidelity, and recognizes NNTA, a PAM sequence... create the adenine base editor. The TadA domain has also been further evolved to catalyze cytidine deamination...editing requires more optimization and typically has lower efficiency (< 50%) than base editing (> 90%...modifications to eliminate target gene function. It has also been used extensively to screen for novel genes... those for yeast or drosophila . Although CRISPR has been less widely used in bacteria due to technical...
  9. Antibody Validation Using the Indirect ELISA Method

    Type
    Protocol
    ...periodically to determine when the desired color change has occurred. The color will change from yellow to blue...experimental conditions. When the desired color change has occurred, gently remove the plate seal. Using a multichannel...
  10. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...vector is the backbone upon which The RNAi Consortium has built a library of shRNAs directed against 15,000...shRNA insert. The original pLKO.1-TRC cloning vector has a 1.9kb stuffer that is released by digestion with... the sequencing conditions if the DNA polymerase has difficulty reading through the secondary structure... in contact with the walls of the tube before it has been diluted. Mix by swirling or gently flicking ...
  11. The Blue Flame Award: Celebrating Addgene's Most Requested Depositors

    Type
    Blog Post
    ...indicates that a plasmid has been requested 20+ times   A red flame means a plasmid has been requested 50+ ... Castro of University of Michigan says, “Addgene has transformed the way in which we share plasmids and...making it easier, cost effective and faster; this has helped accelerate scientific discoveries.” Occasionally...+ times   A blue flame means a plasmid has been requested 100+ times Since we so sincerely appreciate ...have at least one plasmid deposited at Addgene that has been distributed more than 100 times. We hope these...sharing because, as UNC’s Bryan Roth says, Addgene has “literally enabled sharing with 100's of investigators...popularity of CRISPR in the plant community, this has saved us hours of work responding to requests from...
  12. RANbodies: Reporter Nanobody Fusions

    Type
    Blog Post
    ...discussed in more detail below. The HA tag can be stained for with an anti-HA antibody and serves as a backup...detected either with a labeled anti- HA or -MYC antibody or with an anti-HA or -MYC primary and a labeled secondary...Gelsolin Spaghetti Monster: HA (H) or Myc (M) versions Labeled anti-HA or -Myc antibody Staining cultured...detectable by two different tags: a reporter and an HA tag. The reporter comes in three varieties: HRP, ...independent of the reporter. The only caveat is that HA staining is weaker than reporter staining. Picking...Spaghetti Monsters are highly antigenic tags that have 10 HA or 10 MYC tags built into a GFP scaffold. Some GFP...recognize this GFP scaffold itself. Fortunately the GFP1 HA Spaghetti Monster RANbody doesn’t recognize the scaffold...
  13. Antibody Guide

    Type
    Guide
    ... immune response to it. Once the immune response has developed, the antibodies are collected, tested against...epitopes on constant regions of other antibodies. This has useful research applications, and is covered in the...exist as monomers. Each antibody class therefore has a valency, or number of binding sites available per...of antibodies multiplied by two, as each antibody has two binding sites. Isotype Description Configuration... must be able to detect if and where an antibody has bound. Signaling molecules , proteins that emit a...to avoid confusing data. Check that your machine has appropriate lasers and filters for each fluorophore...
  14. New CRISPR Web Resources and #12DaysofCRISPR Recap

    Type
    Blog Post
    ...base editor pCMV-BE3 has been requested nearly 400 times, and newcomer pCMV-ABE7.10 has already earned a ... CRISPR has made it possible to design programmable epigenome editing tools, and the field has certainly...Since the start of the CRISPR revolution, Addgene has distributed over 100,000 CRISPR plasmids. But that...have available by category. Each plasmid page now has a helpful graphic to introduce you to the plasmid... the Transcriptional Regulation category already has five blue flame plasmids covering three different...LwCas13a guide expression backbone with U6 promoter has already earned a blue flame. RNA Editing: Did anyone...
  15. Antibodies 101: Epitope Tags

    Type
    Blog Post
    ...Addgene has you covered with monoclonal antibodies to Myc for all of these species. HA The HA tag is ... The tag has two negatively charged amino acids for an overall negative charge. This tag has been used...charged and 2 positively charged amino acids. FLAG tag has been used with moderate to high success rates across...from the protooncogene of the same name. The tag has a net negative charge with 4 negatively charged and...antibody can’t be used or that step can be skipped. It has the flexibility of also being used for immunoprecipitation...antibodies or guidance on designing a GFP tag Addgene has you covered!   Potential tag issues Tags have a lot...
  16. Mesothelioma - Causes, Symptoms, and Treatment

    Type
    Blog Post
    ...misdiagnosed, meaning that by the time it has caught it has usually started to spread (metastasize) and...and treatments such as these has brought a lot of promise to a field that has historically been full of ...have spread while Stage 4 indicates that the cancer has spread from where it originated to another organ ...However, as the U.S. Environmental Protection Agency has noted, there is no safe level of asbestos exposure...abdominal cavity. This targeted chemotherapy approach has been shown to be successful in killing many (if not...patients: early detection and immunotherapy.  It has long been known that one of the best ways to improve...standard treatments and early detection, mesothelioma has proven itself to be susceptible to up and coming ...
  17. Five Popular Model Organisms, Part 2

    Type
    Blog Post
    ... an essential aspect of biological research that has defined our understanding of biological processes...model organisms is Escherichia coli. The bacterium has been used as a model organism for over 60 years with...cloning and metabolic engineering.  The E. coli genome has an extensive research history and characterization...studies. For example the E. coli biotin ligase, BirA, has been used to identify and study protein-protein interactions...APEX (Rhee et al., 2013). Research using E. coli has the potential to address many areas of microbial ...research with an archive of information and data that has yet to be produced with mice (Iannaccone et al., ..., 2009). While the rat as a model organism has its perks, it is far from perfect. One of the most limiting...
Showing: 81 - 100 of 858 results