We narrowed to 88 results for: LucY

...Use this AAV CRISPR knockout library expressing luciferase and Cre to interrogate tumorigenesis in vivo ...

...as a safeguard against bacteriophages was not elucidated until 2007. Scientists hypothesized that prokaryotes...

...pSBtet-GP Sleeping Beauty transposon system with luciferase in cloning site. See article ( Kowarz et al.,...

...AGTCAAGTAACAACCGCGA 3' end of luciferase Forward LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase Reverse M13 Forward...Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase Forward RVprimer3 CTAGCAAAATAGGCTGTCCC 5' of ...

...Michael Davidson Fluorescent Protein Collection Luciferase Plasmid Collection Promega Plasmid Collection...

...These plasmids contain a reporter gene (e.g., luciferase or GFP) that offers a readout of the activity...of interest could be inserted upstream of the luciferase gene to determine the level of transcription ...that promoter. Fluorescent Protein Plasmids , Luciferase Plasmids Viral Plasmids These plasmids are modified...

...Optogenetics Plasmids Viral Service: AAV Biosensors Luciferase Plasmids Promega Plasmid Collection Explore the...

...permit reversible loss-of-function screening to elucidate which genes are involved in a phenotype. They ...