We narrowed to 85 results for: LucY
-
TypeCollection...pSBtet-GP Sleeping Beauty transposon system with luciferase in cloning site. See article ( Kowarz et al.,...
-
Validated gRNA Sequences
TypeCollection...AGACGACCCTGTCATCCGCA 74188 cut S. pyogenes 26627737 Moffat Luciferase ACAACTTTACCGACCGCGCC 74190 cut S. pyogenes 26627737... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...Fusion Construct Kit Neveu Lab MXS Chaining Kit Luciferase Plasmid Collection Promega Plasmid Collection... -
Neurodegeneration Plasmid Collection
TypeCollection... MAPT T5, luciferase CMV Parkinson's, FTD Eugene Yeo 214673 lucMAPT-30U MAPT T5, luciferase CMV Parkinson's...FTD Eugene Yeo 214674 lucMAPT-GenRep MAPT T5, luciferase CMV Parkinson's, FTD Eugene Yeo 214814 U6_ ATM_G101... -
Fluorescent Protein Guide: Biosensors
TypeCollection...You may also like... Addgene Blog: Biosensors Luciferase Plasmids Optogenetics Plasmids Viral Service:...