We narrowed to 89 results for: LucY

...as a safeguard against bacteriophages was not elucidated until 2007. Scientists hypothesized that prokaryotes...

...pSBtet-GP Sleeping Beauty transposon system with luciferase in cloning site. See article ( Kowarz et al.,...

...Michael Davidson Fluorescent Protein Collection Luciferase Plasmid Collection Promega Plasmid Collection...

...light-emitting luciferase and a light-sensing optogenetic element. When the luciferase substrate (luciferin) is ...efficiencies. Depending on the type of luciferase used, the luciferin substrate may be the native coelenterazine...is added, the luciferase enzyme generates light that activates the opsin. The opsin may excite or inhibit...Coupling brighter bioluminescent modules, such as luciferase-fluorescent protein fusions, to more-sensitive...Descriptions of LMOs and their activity in neurons LMO Luciferase Opsin Ligand Effect Outcome Reference LMO3 sbGLuc...

...Optogenetics Plasmids Viral Service: AAV Biosensors Luciferase Plasmids Promega Plasmid Collection Explore the...

...AGTCAAGTAACAACCGCGA 3' end of luciferase Forward LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase Reverse M13 Forward...Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase Forward RVprimer3 CTAGCAAAATAGGCTGTCCC 5' of ...

...These plasmids contain a reporter gene (e.g., luciferase or GFP) that offers a readout of the activity...of interest could be inserted upstream of the luciferase gene to determine the level of transcription ...that promoter. Fluorescent Protein Plasmids , Luciferase Plasmids Viral Plasmids These plasmids are modified...

...-emitting luciferase fused to a light-sensing element such as an opsin. When the luciferase substrate ...substrate is added, the luciferase enzyme generates light that activates the opsin. While LMOs can also be activated...

...permit reversible loss-of-function screening to elucidate which genes are involved in a phenotype. They ...