We narrowed to 104 results for: pcas
-
TypeCollection...ataxia Bruce Tempel 30137 pCAX APP 695 APP CAG Alzheimer's Dennis Selkoe 30138 pCAX APP 751 APP CAG Alzheimer's...Dennis Selkoe 30143 pCAX APP delta CT APP CAG Alzheimer's Dennis Selkoe 30144 pCAX APP AENATA APP CAG ...Dennis Selkoe 30145 pCAX APP Swe/Ind APP CAG Alzheimer's Dennis Selkoe 30146 pCAX APP C99 APP CAG Alzheimer's...Dennis Selkoe 30147 pCAX APPs-695-alpha APP CAG Alzheimer's Dennis Selkoe 30149 pCAX APPs-751-alpha APP...-ko-sgRNA1-SpCas9 TARDBP U6 ALS Rajat Rohatgi 107858 pHBS953 TARDBP-Exon2-ko-sgRNA2-SpCas9 TARDBP U6 ALS...APP CAG Alzheimer's Dennis Selkoe 30154 pCAX FLAG APP APP Flag CAG Alzheimer's Dennis Selkoe 31255 pGEX...pScarlet-Kif5a KIF5A mScarlet CMV ALS Beverly Koller 118745 pCAG-Scarlet-Kif5a KIF5A mScarlet CAG ALS Beverly Koller...
-
CRISPR History and Development for Genome Engineering
TypeCollection...Cas9s: Three high fidelity Cas9 variants , SpCas9-HF, eSpCas9, and HypaCas9 display very low off-target...Researchers have expanded the CRISPR field beyond SpCas9, moving us closer to being able to target every... Staphylococcus aureus (SaCas9) is smaller than SpCas9 and more easily packaged in AAV. Cas9 orthologs... -
Sequencing Primers
TypeGuide...BamHI, reverse primer pCAG-F GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids, forward primer... primer pCasper-F GGGTTTTATTAACTTACAT (Vosshall lab) 5' end of Drosophila mini-white gene, reverse primer...primer pCasper-hs GCAACTACTGAAATCTGCCAAG Drosophila Hsp70 promoter, forward primer pcDL-F GTTGCCTTTACTTCTAGGCCT... -
CRISPR Plasmids - Tagging
TypeCollection... AAVS1 genomic safe harbor locus using untagged SpCas9 (Addgene 41815 or #44719 ) in combination with ...using an all in one vector from the Doyon lab, eSpCas9(1.1)_No_FLAG_AAVS1_T2 (Addgene #79888) , which ... integrating at the AAVS1 "safe harbor" locus: eSpCas9(1.1)_No_FLAG_AAVS1_T2 Doyon Lab TAP Tagging Protocol... -
Fluorescent Protein Guide: Subcellular Localization
TypeCollection... NLS YFP IX Nucleus NLS YFP Connie Cepko 158000 pCaggs-NLS-PAmCherry1-GSS-EGFP Nucleus NLS mGold Francois...FUmGW Membrane Palmitoylation GFP Connie Cepko 14757 pCAG-mGFP Membrane Palmitoylation sequence from GAP43...Actin Filaments LifeAct mCherry Robin Shaw 21948 pCAG-mGFP-Actin Actin Filaments beta-actin EGFP Ryohei... -
Retrovirus Plasmids
TypeCollection...35617 pCAG-Eco Envelope Ecotropic MLV expressing envelope plasmid Nienhuis and Salmon 35616 pCAG-VSVG ... -
Adeno-associated virus (AAV) Plasmids
TypeCollection...plasmid (encoding adenovirus E4, E2A and VA) and a RepCap plasmid (encoding AAV Rep and respective capsid...expressing adenovirus E4, E2A and VA James M. Wilson RepCap Plasmids for Serotypes Available as a Viral Vector... -
Arf GTPase Family
TypeCollection... Mammalian (pcDNA4c, pCAG), Gateway GEF Arfgef2 (BIG2) 10564 1785 Mammalian (pCAG), Gateway GEF Arfgef3... -
Lentivirus Plasmids
TypeCollection...35617 pCAG-Eco N/A Envelope Ecotropic MLV expressing envelope plasmid Nienhuis and Salmon 35616 pCAG-VSVG... -
Genomic Deletions in Mammalian Cell Lines
TypeCollection...purposes. NOTE: Here we discuss the usage of the pSpCas9(BB) plasmid (pX330) (Addgene plasmid ID 42230)....allows for the simultaneous expression of sgRNA and SpCas9, but does not contain markers for selection 1 .... -
Tetracycline Inducible Expression
TypeCollection...with CMV promoter Tet-On 3G rtTA Oskar Laur 96963 pCAG-TetON-3G Mammalian expression of the Tet-On 3G transactivator...viral tTA plasmids. tTA Viviana Gradinaru 104102 pCAG-tTA Mammalian expression of tTA from the CAG promoter... -
Immunology Research Plasmids and Resources
TypeCollection... HSP86, HSP89A, HSP90A, HSP90N, HSPC1, HSPCA, HSPCAL1, HSPCAL4, HSPN, Hsp89, Hsp90, LAP2 HSP90AB1 heat...VIRG, VPAC1, VPCAP1R VIPR2 vasoactive intestinal peptide receptor 2 FLJ16511, VPAC2, VPCAP2R XCL1 chemokine... -
CRISPR Plasmids - RNA Editing
TypeCollection...guanosine, the result is an A->G change in RNA. dPspCas13b does not require a Protospacer Flanking Sequence... -
CRISPR Plasmids - gRNAs
TypeCollection...binding variant of Cas9. For instance, wild-type SpCas9 must be used with targets that are upstream of ... -
Plant Plasmids and Resources
TypeCollection...Kit includes a high efficiency intron-optimized SpCas9-coding gene, zCas9i, and an intronized Cas9 series... -
CRISPR Plasmids - Bacteria
TypeCollection...Kanamycin none, need Cas9 plasmid Marraffini 42876 pCas9 BsaI E. coli, S. pneumoniae Chloramphenicol yes,... -
CRISPR Plasmids - Mammalian Expression
TypeCollection...guanosine, the result is an A->G change in RNA. dPspCas13b does not require a Protospacer Flanking Sequence... -
Control AAV Preps
TypeCollection... Cre dependent 1, 2, 5, 8, 9, rg* Roth 51502 AAV pCAG-FLEX-EGFP-WPRE CAG EGFP Cre dependent 1, 2, 5, 8... -
Rinehart Lab Phosphoprotein Reagents
TypeCollection...BL21ΔserB Plasmid 34624 SepOTSα tRNA-Sep ( aka. pCAT112TAG-SepT) Plasmid 34623 SepOTSα SepRS/EF-Sep ( aka... -
COVID-19 Resources
TypeCollection...2020.05.04.20091231 (Link opens in a new window) AapCas12b plasmid from the Abudayyeh-Gootenberg lab. A one-enzyme...