Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 95 results for: t aav

Showing: 81 - 95 of 95 results

  1. Fluorescent CRISPR Reporters: SRIRACCHA and GEmCherry2

    Type
    Blog Post
    .../10.1038/nbt.2842 Wen Y, Liao G, Pritchard T, Zhao T-T, Connelly JP, Pruett-Miller SM, Blanc V, Davidson...iSRIRACCHA) where Cas9 expression is activated using 4-OH-T and doxycycline. A gRNA that targets your desired ...editing at three different genomic sites in the AAVS1 locus using GEmCherry2. In this experiment they ...

  3. Immunology Research Plasmids and Resources

    Type
    Collection
    ... TRAJ10 T cell receptor alpha joining 10 - TRAJ11 T cell receptor alpha joining 11 - TRAJ12 T cell receptor... TRAJ13 T cell receptor alpha joining 13 - TRAJ14 T cell receptor alpha joining 14 - TRAJ15 T cell receptor... TRAJ16 T cell receptor alpha joining 16 - TRAJ17 T cell receptor alpha joining 17 - TRAJ18 T cell receptor... TRAJ20 T cell receptor alpha joining 20 - TRAJ21 T cell receptor alpha joining 21 - TRAJ22 T cell receptor... TRAJ23 T cell receptor alpha joining 23 - TRAJ24 T cell receptor alpha joining 24 - TRAJ25 T cell receptor... TRAJ26 T cell receptor alpha joining 26 - TRAJ27 T cell receptor alpha joining 27 - TRAJ28 T cell receptor...- TRAJ29 T cell receptor alpha joining 29 - TRAJ3 T cell receptor alpha joining 3 - TRAJ30 T cell receptor...

  4. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...adeno-associated virus (AAV) integration sites in AAV virions during AAV wild-type and recombinant AAV vector production...both key advantages of rAAV vectors. AAV Types Serotypes AAV serotypes are AAV variants that differ in...Parts of the AAV Transfer Plasmid Parts of the AAV Packaging Plasmid Producing Your rAAV AAV Serotypes and...Adeno-Associated Viral (AAV) Vector Guide Jump To: AAV Vectors Vector Production Integration AAV Types Common Uses...Services Packaged-on-Request AAV Preps In-Stock AAV Preps Resources on addgene.org AAV Plasmids Available at ...Virus (AAV) for Cell and Gene Therapy Adeno-associated Viruses (AAVs) for Genome Editing Using AAV for Neuronal...More AAV Vector topics Addgene Protocols General Transfection AAV Production in HEK293T Cells AAV Purification...

  5. Typing CRISPR Systems

    Type
    Blog Post
    ...839–842. https://doi.org/10.1126/science.aav4294 Hu, C., Myers, M. T., Zhou, X., Hou, Z., Lozen, M. L....88–91. https://doi.org/10.1126/science.aav7271 Yoshimi, K., & Mashimo, T. (2022b). Genome editing technology...Joung, J., Belanto, J. J., Verdine, V., Cox, D. B. T., Kellner, M. J., Regev, A., Lander, E. S., Voytas...https://doi.org/10.1126/science.1231143 Cox, D. B. T., Gootenberg, J. S., Abudayyeh, O. O., Franklin, B...Taylor, H. N., Laderman, E., Armbrust, M., Hallmark, T., Keiser, D., Bondy-Denomy, J., & Jackson, R. N. (...

  6. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...pX601 61591 Mammalian/AAV BsaI yes, cut S. aureus Zhang pX602 61593 Mammalian/AAV BsaI yes, cut S. aureus...pyogenes Joung AAV:ITR-U6-sgRNA (Backbone) PCB-FlPO-WPRE-syntetisk pA-UTR 68347 Mammalian/AAV none S. pyogenes...pyogenes mCherry Kuhn AAV:ITR-U6-sgRNA(backbone)-pCBh-Cre-WPRE-hGHpA-ITR 60229 Mammalian/AAV SapI none S. pyogenes...pyogenes Zhang AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR 60231 Mammalian/AAV SapI none...pyogenes Zhang AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR 60226 Mammalian/AAV SapI none S...particular expression system , eg. Mammalian, Lentiviral, AAV, Bacteria, Drosophila, Yeast, Plant, Xenopus, Worm... none S. pyogenes Gersbach PX552 60958 Mammalian/AAV SapI none S. pyogenes Zhang pgRNA-humanized 44248...

  7. Chemogenetics Guide

    Type
    Guide
    ...they drive expression. Different AAV serotypes can be used to target AAV vectors to specific cells of interest...considered. For tissue specificity of AAV serotypes, see our AAV guide . FLEx Vectors are also used to...Slocum ST, DiBerto JF, Xiong Y, Urushihata T, Hirabayashi T, Fujimoto A, Mimura K, English JG, Liu J, ...Tomita Y, Nakahara J, Suhara T, Takada M, Higuchi M, Jin J, Roth BL, Minamimoto T (2020). Deschloroclozapine...models. For viral injection, Adeno-associated virus (AAV) is a widely-used tool for achieving in vivo expression...of chemogenetic receptors, and a wide variety of AAV-encoding chemogenetics plasmids are available. Additionally...available. Browse our collection of Ready-to-use AAV Preparations of Chemogenetic Plasmids ! Table 4. ...

  8. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...113584 (EFS) 113585 (TBG) Knockout Mouse Chen N/A (AAV) 4 286 Mouse Validation (mVAL) CRISPR Library 159391...Prime Editing Other Species Human Mouse Fly Yeast T. gondii E. coli P. aeruginosa S. pneumoniae M. tuberculosis...Moffat 3rd 4 70,948 Toxoplasma Knockout 80636 Knockout T. gondii Lourido N/A 10 8,158 TUNEYALI Library 217744...

  9. Quick Guide to All Things Lentivirus

    Type
    Blog Post
    ...Viral Transductions Learn Why You Might Want to Use AAV in Your Research Lentiviral Vector Uses and Overview... spinoculation, has been found very effective for T cells transduction for instance. I hope you will ...

  10. Plan Your Experiment

    Type
    Guide
    ... collection of in-stock lentiviral preps . AAV vectors AAV vectors offer some advantages for viral vector...delivery. Both lentiviral and AAV vectors are safe to use in the lab, but AAVs exhibits the lowest immunogenicity... transgene expression with AAVs can be long-lived, despite recombinant AAVs not integrating into the host...also frequently use AAVs to develop CRISPR-based therapeutics. One limitation of AAV vectors is that the...blog post on overcoming the AAV size limitation . Browse Addgene's in-stock AAV preps or try Addgene's Packaged...Marjanovic, N. D., Dionne, D., Burks, T., Raychowdhury, R., Adamson, B., Norman, T. M., Lander, E. S., Weissman...delivery, lentiviral and adeno-associated virus (AAV) vectors are the most common. Using viral vectors...

  11. Adenovirus Guide

    Type
    Guide
    ...for replication. For more information about AAVs, read our AAV guide . Recombinant Adenoviral Vectors Wild-type...26289977 (Link opens in a new window) He, T. C., Zhou, S., da Costa, L. T., Yu, J., Kinzler, K. W., & Vogelstein...double-stranded DNA genome. Adeno-associated viruses (AAV), however, are small single-stranded DNA viruses ...viruses that belong to the Parvoviridae family. AAVs were discovered as a contaminant of adenovirus preparations...how they got their name, but they are not related. AAVs require the presence of adenoviral genes E1, E4,... 21453277 (Link opens in a new window) Bulcha, J. T., Wang, Y., Ma, H., Tai, P. W. L., & Gao, G. (2021...Bullard, B. L., Corder, B. N., Gordon, D. N., Pierson, T. C., & Weaver, E. A. (2020). Characterization of a...

  12. Validated gRNA Sequences

    Type
    Collection
    ...48655 cut T. denticola 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48656 cut T. denticola...TGAAGAAAGTTATACTCGA 66099 cut S. pyogenes 25249454 Seydoux T (BRACHYURY) H. sapiens CACGCGCAGTTCGCGCTCTG 59726 ...69239 cut S. pyogenes 26480473 Wolfe TGME49_290860 T. gondii ATTGGTCTGACAGCGATGTG 59855 cut S. pyogenes...Otonkoski AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 58252 cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens...23287722 Church AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 50662 cut S. pyogenes 24336569 Sabatini AAVS1 H. sapiens... 26997482 Yeo AAVS1 H. sapiens TGTCCCTAGTGGCCCCACTG cut S. pyogenes 26789497 Corn AAVS1 H. sapiens ACAGTGGGGCCACTAGGGAC...GGGGCCACTAGGGACAGGAT 70661 cut S. pyogenes 26472758 Sabatini AAVS1 H. sapiens GTCCCCTCCACCCCACAGTG 41817 cut S. pyogenes...

  13. Molecular Biology Reference

    Type
    Guide
    ..., C, or T K G or T M A or C N A, T, C, or G R A or G S C or G V A, C, or G W A or T Y C or T Amino Acids...Guanine T Thymine U Uracil Single Letter Code: Ambiguous bases Nucleobase B C, G, or T D A, G, or T H A, ...A), Thymine (T), Cytosine (C) and Guanine (G). In the double helix A always pairs with T and C always ...viral particles, such as lentiviral, retroviral, AAV, or adenoviral particles, that can infect your target...expanding viral service offers select ready-made AAV and lentiviral particles. Visit our viral service...thymine, cytosine, and guanine (abbreviated to A, T, C, and G respectively) that are organized into a ...complementary, strand. Specifically, A pairs with T and C pairs with G. During replication, DNA unwinds...

  14. CRISPR Guide

    Type
    Guide
    ...INTEGRATE ( I nsertion of T ransposable E lements by G uide R NA- A ssisted T argeting), developed by Samuel...Topkar, V. V., Nguyen, N. T., Zheng, Z., Gonzales, A. P. W., Li, Z., Peterson, R. T., Yeh, J. J., Aryee, M...PMID: 28041849 Sakuma, T., Nishikawa, A., Kume, S., Chayama, K., & Yamamoto, T. (2014). Multiplex genome... R. T., Silverstein, R. A., Amrani, N., Peng, C., Kramme, C., Savic, N., Pacesa, M., Rodríguez, T. C.,... (22), 5635-5652.e29. PMID: 34653350 Chu, V. T., Weber, T., Wefers, B., Wurst, W., Sander, S., Rajewsky... Gao, L., Cox, D. B. T., Yan, W. X., Manteiga, J. C., Schneider, M. W., Yamano, T., Nishimasu, H., Nureki...Y., Nakada, S., Yamamoto, T., Sano, S., Hotta, A., Takeda, J., & Mashimo, T. (2019). CRISPR-Cas3 induces...

  15. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    .... We also offer ready-to-use AAV preparations of select plasmids and AAV Packaged on Request for many ...Localization Optogenetics Plasmids Viral Service: AAV Biosensors Fluorescent biosensors are proteins designed...Commun. 2018 Oct 25;9(1):4440. Eric Schreiter Calcium AAV expression of photoconvertible fluorescent protein-based...2024.12.16.628673. Olivia Masseck Calcium Astrocyte AAV-mediated expression of jRCaMP1a, a red fluorescent...Gadella Calcium Teal genetically encoded calcium sensor T-GECI Blue-shifted genetically encoded Ca(2+) indicator...voltage imaging. Science. 2019 Aug 1. pii: science.aav6416. Eric Schreiter Voltage Green fluorescent voltage...
Showing: 81 - 95 of 95 results