Skip to main content
Addgene
Showing: 81 - 92 of 92 results

  1. Fluorescent CRISPR Reporters: SRIRACCHA and GEmCherry2

    Type
    Blog Post
    .../10.1038/nbt.2842 Wen Y, Liao G, Pritchard T, Zhao T-T, Connelly JP, Pruett-Miller SM, Blanc V, Davidson...iSRIRACCHA) where Cas9 expression is activated using 4-OH-T and doxycycline. A gRNA that targets your desired ...editing at three different genomic sites in the AAVS1 locus using GEmCherry2. In this experiment they ...

  3. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...pX601 61591 Mammalian/AAV BsaI yes, cut S. aureus Zhang pX602 61593 Mammalian/AAV BsaI yes, cut S. aureus...pyogenes Joung AAV:ITR-U6-sgRNA (Backbone) PCB-FlPO-WPRE-syntetisk pA-UTR 68347 Mammalian/AAV none S. pyogenes...pyogenes mCherry Kuhn AAV:ITR-U6-sgRNA(backbone)-pCBh-Cre-WPRE-hGHpA-ITR 60229 Mammalian/AAV SapI none S. pyogenes...pyogenes Zhang AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR 60231 Mammalian/AAV SapI none...pyogenes Zhang AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR 60226 Mammalian/AAV SapI none S...particular expression system , eg. Mammalian, Lentiviral, AAV, Bacteria, Drosophila, Yeast, Plant, Xenopus, Worm... none S. pyogenes Gersbach PX552 60958 Mammalian/AAV SapI none S. pyogenes Zhang pgRNA-humanized 44248...

  4. Typing CRISPR Systems

    Type
    Blog Post
    ...839–842. https://doi.org/10.1126/science.aav4294 Hu, C., Myers, M. T., Zhou, X., Hou, Z., Lozen, M. L....88–91. https://doi.org/10.1126/science.aav7271 Yoshimi, K., & Mashimo, T. (2022b). Genome editing technology...Joung, J., Belanto, J. J., Verdine, V., Cox, D. B. T., Kellner, M. J., Regev, A., Lander, E. S., Voytas...https://doi.org/10.1126/science.1231143 Cox, D. B. T., Gootenberg, J. S., Abudayyeh, O. O., Franklin, B...Taylor, H. N., Laderman, E., Armbrust, M., Hallmark, T., Keiser, D., Bondy-Denomy, J., & Jackson, R. N. (...

  5. Adenovirus Guide

    Type
    Guide
    ... Adenoviral Vectors Are adenovirus and AAV different? Yes! AAV is a small single-stranded DNA parvovirus...for replication. For more information about AAV, read our AAV guide . Can I make a stable cell line with...double-stranded DNA viruses. They are not related; however, AAV requires the presence of adenoviral genes E1, E4,...transcripts. At either end of the genome are i nverted t erminal r epeats (ITRs). Genes are divided into early...

  6. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...113584 (EFS) 113585 (TBG) Knockout Mouse Chen N/A (AAV) 4 286 Mouse Validation (mVAL) CRISPR Library 159391...Prime Editing Other Species Human Mouse Fly Yeast T. gondii E. coli S. pneumoniae M. tuberculosis M. smegmatis...Moffat 3rd 4 70,948 Toxoplasma Knockout 80636 Knockout T. gondii Lourido N/A 10 8,158 Turner Lab Human messenger-RBP...

  7. Quick Guide to All Things Lentivirus

    Type
    Blog Post
    ...Viral Transductions Learn Why You Might Want to Use AAV in Your Research Lentiviral Vector Uses and Overview... spinoculation, has been found very effective for T cells transduction for instance. I hope you will ...

  8. Molecular Biology Reference

    Type
    Guide
    ..., C, or T K G or T M A or C N A, T, C, or G R A or G S C or G V A, C, or G W A or T Y C or T Amino Acids...Guanine T Thymine U Uracil Single Letter Code: Ambiguous bases Nucleobase B C, G, or T D A, G, or T H A, ...A), Thymine (T), Cytosine (C) and Guanine (G). In the double helix A always pairs with T and C always ...viral particles, such as lentiviral, retroviral, AAV, or adenoviral particles, that can infect your target...expanding viral service offers select ready-made AAV and lentiviral particles. Visit our viral service...thymine, cytosine, and guanine (abbreviated to A, T, C, and G respectively) that are organized into a ...complementary, strand. Specifically, A pairs with T and C pairs with G. During replication, DNA unwinds...

  9. Plan Your Experiment

    Type
    Guide
    ... screens using CRISPR AAV transduction CRISPR elements are inserted into an AAV transfer vector and used...used to generate AAV particles (for details, see our AAV Guide ) ∼4.5 kb packaging limit (only compatible.../or gRNA Infects dividing and non-dividing cells AAV is the least toxic method for in vivo viral delivery...197–217. PMID: 25408407 Hashimoto, M., & Takemoto, T. (2015). Electroporation enables the efficient mRNA...

  10. CRISPR Guide

    Type
    Guide
    ...INTEGRATE ( I nsertion of T ransposable E lements by G uide R NA- A ssisted T argeting), developed by Samuel...Topkar, V. V., Nguyen, N. T., Zheng, Z., Gonzales, A. P. W., Li, Z., Peterson, R. T., Yeh, J. J., Aryee, M...PMID: 28041849 Sakuma, T., Nishikawa, A., Kume, S., Chayama, K., & Yamamoto, T. (2014). Multiplex genome... R. T., Silverstein, R. A., Amrani, N., Peng, C., Kramme, C., Savic, N., Pacesa, M., Rodríguez, T. C.,... (22), 5635-5652.e29. PMID: 34653350 Chu, V. T., Weber, T., Wefers, B., Wurst, W., Sander, S., Rajewsky... Gao, L., Cox, D. B. T., Yan, W. X., Manteiga, J. C., Schneider, M. W., Yamano, T., Nishimasu, H., Nureki...Y., Nakada, S., Yamamoto, T., Sano, S., Hotta, A., Takeda, J., & Mashimo, T. (2019). CRISPR-Cas3 induces...

  11. Validated gRNA Sequences

    Type
    Collection
    ...48655 cut T. denticola 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48656 cut T. denticola...TGAAGAAAGTTATACTCGA 66099 cut S. pyogenes 25249454 Seydoux T (BRACHYURY) H. sapiens CACGCGCAGTTCGCGCTCTG 59726 ...69239 cut S. pyogenes 26480473 Wolfe TGME49_290860 T. gondii ATTGGTCTGACAGCGATGTG 59855 cut S. pyogenes...Otonkoski AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 58252 cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens...23287722 Church AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 50662 cut S. pyogenes 24336569 Sabatini AAVS1 H. sapiens... 26997482 Yeo AAVS1 H. sapiens TGTCCCTAGTGGCCCCACTG cut S. pyogenes 26789497 Corn AAVS1 H. sapiens ACAGTGGGGCCACTAGGGAC...GGGGCCACTAGGGACAGGAT 70661 cut S. pyogenes 26472758 Sabatini AAVS1 H. sapiens GTCCCCTCCACCCCACAGTG 41817 cut S. pyogenes...

  12. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Localization Optogenetics Plasmids Viral Service: AAV Biosensors Fluorescent biosensors are proteins designed...associated with the article. We also offer ready-to-use AAV preparations of select plasmids; these are noted ...Commun. 2018 Oct 25;9(1):4440. Eric Schreiter Calcium AAV expression of photoconvertible fluorescent protein-based...2024.12.16.628673. Olivia Masseck Calcium Astrocyte AAV-mediated expression of jRCaMP1a, a red fluorescent...Gadella Calcium Teal genetically encoded calcium sensor T-GECI Blue-shifted genetically encoded Ca(2+) indicator...voltage imaging. Science. 2019 Aug 1. pii: science.aav6416. Eric Schreiter Voltage Green fluorescent voltage...
Showing: 81 - 92 of 92 results