Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 1,027 results for: CAT

Showing: 981 - 1000 of 1027 results

  1. Protocol - How to Perform Sequence Analysis

    Type
    Protocol
    ...Although your sequencing results may indicate bases at specific locations, by looking at the trace file, you...Diagnostic Restriction Digest Introduction Sequence verification of important plasmid features (such as the gene...file and use the search feature in the program to locate the incorrect sequence. Look at the peaks in the...after base 70 there are multiple peaks in the same location. Looking at the trace file will give you more...

  2. Ligation Independent Cloning

    Type
    Protocol
    ... plasmid together through the transformation/replication process. LIC employs long overhangs to form a...nicked vector product is then repaired during the replication cycle. Empty vectors for LIC typically employ...mixture by gel electrophoresis followed by gel purification . The cut vector end will now look like this...μl Step 4: Amplify Insert by PCR Perform PCR amplification of your insert following the instructions provided...following step. This may be accomplished by gel purification . Step 5: Create Insert Overhangs Treat your...

  3. Video Library

    Type
    Protocol
    ... Educational Resources Addgene Videos Addgene Videos Browse...lab Over-Agar Antibiotic Plating Protocol AAV Purification Purify adeno-associated virus from a preparation...preparation produced in mammalian cells AAV Purification by Iodixanol Gradient Ultracentrifugation Protocol...separating DNA by size for visualization and purification. Agarose Gel Electrophoresis Protocol Purifying...Purifying DNA from an Agarose Gel Gel purification allows you to isolate and purify DNA fragments based on...

  4. Lentivirus ddPCR Titration

    Type
    Protocol
    ... sample. This protocol was modified from the publication Wang et al. (2018) . Before Starting Thaw the...Scientific, 10199-452 Reagents GeneJet Genomic DNA Purification Kit, Thermo Fisher, K0721 6-well tissue culture...without calcium or magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) Trypsin...FAM): tttggaatcacacgacct reverse primer: aatttctctgtcccactccatc PrimePCR ddPCR Copy Number Assay: RPP30...the next dilution. Repeat for all dilutions as indicated in the chart below. Dilution Factor Virus Volume...genomic DNA according to the GeneJet Genomic DNA Purification Kit instructions. Determine the concentration...

  5. Molecular Biology Protocol - Restriction Digest of Plasmid DNA

    Type
    Protocol
    ...The amount of DNA that you cut depends on your application. A diagnostic digest typically involves ∼500 ...volume usually varies from 10-50 µL depending on application and is largely determined by the volume of DNA...manufacturer’s instructions. Pro-Tip Depending on the application and the amount of DNA in the reaction, incubation...you will be using the digested DNA for another application (such as a digestion with another enzyme in a...70 °C for 15 mins, or purifying the DNA via a purification kit, such as a (Link opens in a new window) ...

  6. Transfection for Recombinant Antibodies

    Type
    Protocol
    ...General Transfection Protocol Recombinant Antibody Purification Protocol Introduction Transfections allow for...antibody can be purified for use in a variety of applications. Sharing speeds science. We believe that sharing...antibody-expressing plasmids containing the SV40 origin of replication use a HEK293 line stably expressing the SV40 ... containing the Epstein-Barr virus origin of replication use a HEK293 line stable expressing Epstein Barr...the supernatant (see our Recombinant Antibody Purification Protocol ). Store the supernatant at 4 °C until...

  7. Protocol - Bacterial Transformation

    Type
    Protocol
    ...bacteria are used as the means for both storing and replicating plasmids. Because of this, nearly all plasmids...expression) carry both a bacterial origin of replication and an antibiotic resistance gene for use as ...bacteria. Scientists have made many genetic modifications to create bacterial strains that can be more...plasmid DNA for the purposes of storage and amplification. Higher efficiency cells are more important ...

  8. Protocol - How to Ligate Plasmid DNA

    Type
    Protocol
    ...performed by the T4 DNA ligase enzyme. The DNA ligase catalyzes the formation of covalent phosphodiester linkages...troubleshooting failed ligations. The following table indicates the various controls: Control Ligase Interpretation... treated vector Insert or water + Any colonies indicate contamination of intact plasmid in ligation or... 3:1 ratio is not working or when doing more complicated cloning. While 3:1 will get you in the ballpark...

  9. Handling Plasmids from Addgene - Purifying Plasmid DNA

    Type
    Protocol
    ... Agarose Gel Electrophoresis Agarose Gel DNA Purification Streaking and Isolating Bacteria Inoculating...instructions. If you want to perform plasmid purification without using a kit, you can find a protocol...Na-acetate (pH 4.8) Protocol: Generalized DNA Purification Grow an overnight culture of bacteria . Pro-...using. Store DNA at 4°C. Tips and FAQ Plasmid purification kits provide the fastest way to obtain a high...

  10. What is Polymerase Chain Reaction (PCR)

    Type
    Protocol
    ...adequately. Divalent cations such as Mg 2+ and Mn 2+ stabilize the buffer solution. These cations can also be ...used for PCR-mediated DNA mutagenesis. A higher cation concentration increases the error rate of the DNA... provide a suitable environment for the DNA amplification reaction. Reference Page Top Index...

  11. Coomassie Purity Stain of Recombinant Antibodies

    Type
    Protocol
    ... Recombinant Antibodies Recombinant Antibody Purification Protocol Introduction This protocol describes...mobility of the bands (sample AR0016 in Figure 1) indicates that the samples may not have been processed correctly...ImageJ. Select File . Select Open . Choose the location of the file to open. Change the image type to ...select the Chart Type drop down menu and select Scatter chart. Change the data range and select the cells...

  12. Protocol - How to Perform a Diagnostic Digest

    Type
    Protocol
    ... . The pattern of the fragments on the gel can indicate if the plasmid contains the expected size insert...before use of more expensive forms of plasmid verification, such as DNA sequencing . In the example above...side of the insert, you can get a very obvious verification of the orientation so long as the expected products...

  13. Lentivirus Production

    Type
    Protocol
    ...lentivirus can be used for a variety of downstream applications such as stable-cell line generation. Workflow...without calcium or magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 0.45...inhibit transfection; therefore, plasmid DNA purification should include an endotoxin removal step. For...

  14. Colony Formation Titering Assay

    Type
    Protocol
    ...without calcium or magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 0.1%...Figure 1: A549 cells were transduced with the indicated serial dilutions of the lentiviral vector pRosetta...Figure 2: A549 cells were transduced with the indicated serial dilutions of the lentiviral vector pHAGE...

  15. Pipetting Protocol

    Type
    Protocol
    ...dispensed. The boxes that the tips come in often indicate a volume range that the tip can hold. This should...no liquid should drip from the tip. This could indicate that the tip is not on the pipette properly. Place...pipette tip by holding the pipette tip over your dedicated waste container and pressing on the tip ejector...

  16. Virus Protocol - Generating Stable Cell Lines

    Type
    Protocol
    ...without calcium or magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 0.45...lower dilutions depending on your downstream applications. If you’ve titered your virus beforehand, you...that the transgene has integrated in different locations in the various cells in the culture. This is because...

  17. Pouring LB Agar Plates

    Type
    Protocol
    ...Tetracycline 10 mg/mL 10 µg/mL Notes: Unless otherwise indicated, the antibiotic powder can be dissolved in dH ...test results. Sample Data In all cases below (-) indicates that the tested strain is not supposed to be resistant... resistant to the antibiotic, (+) indicates that the tested strain is supposed to be resistant to the ...

  18. Protocol - How to Design Primers

    Type
    Protocol
    ...primers produce inaccurate, nonspecific DNA amplification product, and long primers result in a slower...which creates primer dimers and disrupts the amplification process. When designing, if unsure about what...

  20. Fluorescence Titering Assay

    Type
    Protocol
    ... these cells can still be used in downstream applications. Safety Warnings Lentivirus is generally considered...without calcium or magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 0.45...
Showing: 981 - 1000 of 1027 results