We narrowed to 992 results for: Ran
-
TypeGuide... Increases transduction efficiency and transgene expression. Packaging plasmid gag in trans Precursor ...crossover event between the transfer plasmid and genes provided in trans . Transduction The process of artificially...gamma-retroviruses ranges from 9–11 kb, encoded on RNA (Figure 1). This RNA is reverse transcribed into the provirus...need three plasmids (Figure 2): Transfer plasmid — contains transgene, sgRNA, or shRNA of interest flanked...Production Cloning Cloning your transgene, gRNA, or shRNA of interest into the transfer plasmid can be done with...described above (envelope, packaging, and transfer) are co-transfected into the HEK293T packaging cell line... at random locations throughout the genome. Gamma-retroviral vectors tend to prefer transcription start...
-
Plan Your Experiment
TypeGuide...fused to transcriptional activators that need to be within a given range of the transcription start site... interfere with transcription elongation. CRISPR Activation : Target the transcription start site. CRISPRa... perform by chemical transfection or electroporation. Expression can be transient, or you can generate...efficiently transfect. However, note that this method is most useful for cell lines that you can transfect at ...into cells. These methods are more transient than plasmid transfection or viral vectors, reducing the risk...your target cells are not transcribing DNA to mRNA, nor do they need to translate mRNA to protein. Instead...is helpful in cells that are difficult to transfect, transduce, or may not express common promoters. Browse... -
Molecular Biology Reference
TypeGuide...molecular biology, that proteins are translated from RNA, which is transcribed from DNA. The Genetic Code The..., double-stranded helix. To create the double helix, the nucleotides on the opposing strands of DNA form...proteins can be translated, the DNA is converted to RNA in a process called transcription. RNA uses the ...proteins are transcribed and processed into mature messenger RNA (mRNA), which is then translated into proteins...Promoter Region Drives transcription of the insert. The promoter recruits transcriptional machinery and can...nucleotides on opposing strands. A DNA polymerase then binds to the single strand of DNA. Using this as ...synthesized DNA strands of varying lengths whose last nucleotide is labeled. These DNA strands are separated... -
Optogenetics Guide
TypeGuide...wavelengths, ranging from blue to yellow to red. Red light exhibits better tissue penetrance, which may ...including protein activation, membrane localization, and transcriptional activation. In the widely used...synthetic two-part transcription factors - Cry2 and CIB1 are fused to a transcriptional activation domain...trafficking signals to localize opsins to the cell membrane. Microbial opsins, such as those described below... at physiological pH and trafficks well to the membrane. Excitatory (Depolarizing) ChR Variants. The optogenetic...from Kir2.1 and ER export signal provide improved membrane targeting 589 Archaerhodopsins Arch Light-activated...neuronal activation/inactivation periods. These can range from msec (hChR2) to “long lasting,” e.g. seconds... -
Modular Cloning Guide
TypeGuide... mammalian expression vectors for transient or stable transfections. PUF Assembly Kit Mammalian Expression...nucleases (TALENs) and transcription factors (TALE-TFs) for genome editing and transcription modulation applications...assembled into a Level 1 vector creating a single transcriptional unit (for example, a promoter, a 5' UTR, a ...E. coli to maintain the final plasmid after transformation. Figure 1: Overview of the MoClo Toolkit components...multigene constructs. MoClo Plant Parts III: Transformation & Genome Engineering Kit Plant Expression, ...several cassettes and generate multi-construct transgenic plants. GreenGate 2.0 Toolkit Plant Expression...components to create plasmids with multiple transcriptional units. MultiGreen Kit Plant Expression Wayne... -
Antibody Guide
TypeGuide...proteins by size. Transfer proteins from the gel to a membrane. Incubate the membrane with an unconjugated...block the membrane to remove excess antibody and prevent unwanted binding. Incubate the membrane with a ...Wash and block the membrane. Activate the HRP with a substrate kit. Image the membrane using either X-ray...hybridoma cells into plasmids. Plasmids are then transfected into cells and induced to express antibodies....variable regions, shown in light blue and light orange, that bind to a specific antigen, triggering an...constant region, and is shown in dark blue and dark orange. The constant region is a stable part of the antibody...responsible for the variable region goes through a randomized reorganization process, creating a unique binding... -
Molecular Cloning Techniques
TypeGuide...by certain bacteria and archaea, cleave double-stranded DNA (dsDNA) at specific sequence sites in the ...into fragments containing precise 5' or 3' single-strand overhangs (sticky ends), or no overhang (blunt ... They also cut specific target sequences, which range from four to 13 base pairs, and produce predictable... with four nicks that bacteria repair after transformation. LIC does not require site-specific recombination...exonuclease until a base is exposed on the single-strand overhang that is complementary to the free nucleotide... is rendered unnecessary. The product may be transformed directly into E. coli , where the normal replication... recombination abilities of yeast. By simply transforming into yeast two (or more) fragments of dsDNA ... -
Chemogenetics Guide
TypeGuide...cell surface receptors, GPCRs are seven-pass transmembrane proteins that bind a specific ligand. Ligand...initiating signaling pathways in inflammation and neurotransmission. This, and the fact that GPCR ligands can ...in Japan, making it an attractive option for translational studies, however, it has off-target effects....hM4Di, and is especially attractive for use in translational studies because it is FDA and EMA approved. ...muscarinic Arrestin-2/-3 CNO* Increase Arrestin translocation Arrestin signalling Nakajima & Wess, 2012 hM3Dq...j.neuron.2016.01.040 PMID: 26889809 Slaviero, A. N., Gorantla, N., Simkins, J., Crespo, E. L., Ikefuama, E. ... at the hM4D(Gi) DREADD amenable to clinical translation of chemogenetics. Sci Adv, 5 (4), eaaw1567. https... -
Sequencing Primers
TypeGuide...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward SP6 ATTTAGGTGACACTATAG SP6 promoter Forward...recombinase Reverse CYC1 GCGTGAATGTAAGCGTGAC CYC1 transcriptioin termination signal/td> Reverse DsRed1-C AGCTGGACATCACCTCCCACAACG...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward pGP704-R AACAAGCCAGGGATGTAACG R6K gamma...Reverse Tn7-end GGGGTGGAAATGGAGTTTTT Bacteria transposon Tn7 Reverse? TRC-F CAAGGCTGTTAGAGAGATAATTGGA ... -
Educational Resources
TypeGuide...protocols, our educational resources cover a wide range of topics in molecular biology, laboratory research...Protocols Find written and video protocols for a wide range of applications in molecular biology, plasmid cloning...virus, including: Gel Electrophoresis Bacterial Transformation Plasmid Cloning Creating Bacterial Glycerol... -
Addgene's eBook Collection
TypeGuide...First Edition, trans. About CRISPR 101 en español January 2024 | First Edition, trans. About Una traducción...and management, resources for identifying your transferable skills, and tips on the job application process... -
Guide to Using Pooled Libraries
TypeGuide...Barcoding libraries contain plasmids with unique, semi-random sequences that can be used for applications like...large numbers of cells minimizes the effects of random chance that could lead to false positive or negative...