We narrowed to 988 results for: Ran

... mammalian expression vectors for transient or stable transfections. PUF Assembly Kit Mammalian Expression...nucleases (TALENs) and transcription factors (TALE-TFs) for genome editing and transcription modulation applications...assembled into a Level 1 vector creating a single transcriptional unit (for example, a promoter, a 5' UTR, a ...E. coli to maintain the final plasmid after transformation. Figure 1: Overview of the MoClo Toolkit components...multigene constructs. MoClo Plant Parts III: Transformation & Genome Engineering Kit Plant Expression, ...several cassettes and generate multi-construct transgenic plants. GreenGate 2.0 Toolkit Plant Expression...components to create plasmids with multiple transcriptional units. MultiGreen Kit Plant Expression Wayne...

...proteins by size. Transfer proteins from the gel to a membrane. Incubate the membrane with an unconjugated...block the membrane to remove excess antibody and prevent unwanted binding. Incubate the membrane with a ...Wash and block the membrane. Activate the HRP with a substrate kit. Image the membrane using either X-ray...hybridoma cells into plasmids. Plasmids are then transfected into cells and induced to express antibodies....variable regions, shown in light blue and light orange, that bind to a specific antigen, triggering an...constant region, and is shown in dark blue and dark orange. The constant region is a stable part of the antibody...responsible for the variable region goes through a randomized reorganization process, creating a unique binding...

...generate two-part transcription factors, where Cry2 and CIB1 are fused to a transcriptional activation domain...and close when exposed to light and change the membrane potential, a behavior that can be harnessed for...trafficking signals to localize opsins to the cell membrane. Microbial opsins, such as those described below...conductance at physiological pH and traffics well to the membrane. The optogenetic toolbox has been expanded by ... exposure. OptoXRs and OptoGPCRs enable a broad range of pathways to be activated and explored, especially... from Kir2.1 and ER export signal for improved membrane targeting 589 Archaerhodopsins Name Description...kinase activity, localization, gene editing, transcriptional activation, and more. In addition to systems...

...by certain bacteria and archaea, cleave double-stranded DNA (dsDNA) at specific sequence sites in the ...into fragments containing precise 5' or 3' single-strand overhangs (sticky ends), or no overhang (blunt ... They also cut specific target sequences, which range from four to 13 base pairs, and produce predictable... with four nicks that bacteria repair after transformation. LIC does not require site-specific recombination...exonuclease until a base is exposed on the single-strand overhang that is complementary to the free nucleotide... is rendered unnecessary. The product may be transformed directly into E. coli , where the normal replication... recombination abilities of yeast. By simply transforming into yeast two (or more) fragments of dsDNA ...

...cell surface receptors, GPCRs are seven-pass transmembrane proteins that bind a specific ligand. Ligand...initiating signaling pathways in inflammation and neurotransmission. This, and the fact that GPCR ligands can ...in Japan, making it an attractive option for translational studies, however, it has off-target effects....hM4Di, and is especially attractive for use in translational studies because it is FDA- and EMA-approved....muscarinic Arrestin-2/-3 CNO Increase Arrestin translocation Arrestin signalling Nakajima & Wess, 2012 hM3Dq...j.neuron.2016.01.040 PMID: 26889809 Slaviero, A. N., Gorantla, N., Simkins, J., Crespo, E. L., Ikefuama, E. ... at the hM4D(Gi) DREADD amenable to clinical translation of chemogenetics. Sci Adv, 5 (4), eaaw1567. https...

...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward SP6 ATTTAGGTGACACTATAG SP6 promoter Forward...recombinase Reverse CYC1 GCGTGAATGTAAGCGTGAC CYC1 transcriptioin termination signal/td> Reverse DsRed1-C AGCTGGACATCACCTCCCACAACG...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward pGP704-R AACAAGCCAGGGATGTAACG R6K gamma...Reverse Tn7-end GGGGTGGAAATGGAGTTTTT Bacteria transposon Tn7 Reverse? TRC-F CAAGGCTGTTAGAGAGATAATTGGA ...

...protocols, our educational resources cover a wide range of topics in molecular biology, laboratory research...Protocols Find written and video protocols for a wide range of applications in molecular biology, plasmid cloning...virus, including: Gel Electrophoresis Bacterial Transformation Plasmid Cloning Creating Bacterial Glycerol...

...First Edition, trans. About CRISPR 101 en español January 2024 | First Edition, trans. About Una traducción...and management, resources for identifying your transferable skills, and tips on the job application process...