Skip to main content

We narrowed to 17 results for: Ran

Showing: 1 - 17 of 17 results
  1. CRISPR Guide

    Type
    Guide
    ..., 1163–1171. PMID: 23979020 Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P. D...38688943 Hsu, P. D., Scott, D. A., Weinstein, J. A., Ran, F. A., Konermann, S., Agarwala, V., Li, Y., Fine..., 17 (5), 471–479. PMID: 32203383 Nishimasu, H., Ran, F. A., Hsu, P. D., Konermann, S., Shehata, S. I....CRISPR-Cas9. Cell , 167 (7), 1829-1838.e9. PMID: 27984730 Ran, F. A., Hsu, P. D., Wright, J., Agarwala, V., Scott...Nature Protocols , 8 (11), 2281–2308. PMID: 24157548 Ran, F. A., Cong, L., Yan, W. X., Scott, D. A., Gootenberg...may be a single-stranded oligonucleotide, double-stranded linear DNA, or a double-stranded DNA (dsDNA) plasmid...including transposons, integrases, and recombinases, with Cas enzymes. CRISPR Transposases Transposon systems...
  2. Lentiviral Vector Guide

    Type
    Guide
    ...deletion is transferred to the 5’ LTR after one round of reverse transcription, inhibiting transcription of the...cannot be used in direct transfections for transient expression of a transgene. For more detailed protocols... Increases transduction efficiency and transgene expression. Packaging plasmid gag in trans Precursor ...packaging plasmids. tat in trans Trans-activator; binds TAR to activate transcription from the LTR promoter...crossover event between the transfer plasmid and genes provided in trans . Transduction The process of artificially... typically ranges from 8–10 kb, encoded on RNA (Figure 1). This RNA is reverse transcribed into the provirus...for third generation) plasmids: Transfer plasmid — contains transgene, sgRNA, or shRNA of interest flanked...
  3. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...double-stranded DNA genome. Adeno-associated viruses (AAV), however, are small single-stranded DNA viruses...plasmids are needed: Transfer plasmid (also known as cis plasmid) — containing the transgene of interest between...Production Cloning Cloning your transgene, gRNA, or shRNA of interest into the transfer plasmid can be done with...three production plasmids (transfer, packaging, and helper plasmid) are transfected into cells which then ... to display neuronal retrograde transport, AAVrg. Retrograde transport refers to the direction of movement...machinery to synthesize the complementary strand, transgene expression may be delayed. To overcome this...express a viral element necessary for RABV trans-synaptic transport. Learn more about these and other initiatives...
  4. Adenovirus Guide

    Type
    Guide
    ... the transduced cells, transgene expression delivered through rAdV vectors is normally transient and short-lived...Adenoviral genomes range between 26–45 kb in length and contain multiple heavily-spliced transcripts flanked by...double-stranded DNA genome. Adeno-associated viruses (AAV), however, are small single-stranded DNA viruses... and late adenoviral transcript regions between the two ITRs with the transgenes of interest. The size...Shuttle plasmid (also known as transfer plasmid) — containing the transgene of interest, the ITRs, and homology...possibility that recombination between the transfected adenoviral transfer plasmid and the E1 region integrated...Production Cloning Cloning your transgene, gRNA, or shRNA of interest into the transfer plasmid can be done with...
  5. Promoters

    Type
    Guide
    ...sense or coding strand of the transcribed gene (Figure 1). The coding strand is the DNA strand that encodes...to the mRNA transcript produced. The antisense strand is referred to as the template strand or noncoding...noncoding strand, as this is the strand that is transcribed by the RNA polymerase. Figure 1: Simplified promoter...initiation of transcription, whereas transcription factors promote the initiation of transcription. The binding...template for the translation of a protein. RNA polymerase III — transcribes genes encoding transfer RNAs (tRNA... eukaryotic promoters, including transcription and the transcription complex. Educational...to DNA. RNA polymerase transcribes DNA to mRNA, which is ultimately translated into a functional protein...
  6. Gamma-Retroviral Vector Guide

    Type
    Guide
    ... Increases transduction efficiency and transgene expression. Packaging plasmid gag in trans Precursor ...crossover event between the transfer plasmid and genes provided in trans . Transduction The process of artificially...gamma-retroviruses ranges from 9–11 kb, encoded on RNA (Figure 1). This RNA is reverse transcribed into the provirus...need three plasmids (Figure 2): Transfer plasmid — contains transgene, sgRNA, or shRNA of interest flanked...Production Cloning Cloning your transgene, gRNA, or shRNA of interest into the transfer plasmid can be done with...described above (envelope, packaging, and transfer) are co-transfected into the HEK293T packaging cell line... at random locations throughout the genome. Gamma-retroviral vectors tend to prefer transcription start...
  7. Plan Your Experiment

    Type
    Guide
    ...fused to transcriptional activators that need to be within a given range of the transcription start site... interfere with transcription elongation. CRISPR Activation : Target the transcription start site. CRISPRa... perform by chemical transfection or electroporation. Expression can be transient, or you can generate...efficiently transfect. However, note that this method is most useful for cell lines that you can transfect at ...into cells. These methods are more transient than plasmid transfection or viral vectors, reducing the risk...your target cells are not transcribing DNA to mRNA, nor do they need to translate mRNA to protein. Instead...is helpful in cells that are difficult to transfect, transduce, or may not express common promoters. Browse...
  8. Molecular Biology Reference

    Type
    Guide
    ...molecular biology, that proteins are translated from RNA, which is transcribed from DNA. The Genetic Code The..., double-stranded helix. To create the double helix, the nucleotides on the opposing strands of DNA form...proteins can be translated, the DNA is converted to RNA in a process called transcription. RNA uses the ...proteins are transcribed and processed into mature messenger RNA (mRNA), which is then translated into proteins...Promoter Region Drives transcription of the insert. The promoter recruits transcriptional machinery and can...nucleotides on opposing strands. A DNA polymerase then binds to the single strand of DNA. Using this as ...synthesized DNA strands of varying lengths whose last nucleotide is labeled. These DNA strands are separated...
  9. Guide to Using Pooled Libraries

    Type
    Guide
    ...libraries contain plasmids with unique, semi-random or random sequences that can be used for applications...proteins (such as cell surface receptors or transcription factors), or observing the effects of mutagenesis...large numbers of plasmids, each with a short, randomized, unique nucleotide sequence, or barcode, used...libraries direct an inactive Cas enzyme fused to a transcriptional activator to target genes or regulatory regions...regions, where it stimulates transcription by recruiting activators or modifying local chromatin. Inhibition...an inactive Cas enzyme (alone or fused to a transcriptional repressor) to target genes, where it represses...represses expression by blocking transcription initiation or modifying local chromatin. Base Edit : CRISPR...
  10. Modular Cloning Guide

    Type
    Guide
    ... mammalian expression vectors for transient or stable transfections. PUF Assembly Kit Mammalian Expression...nucleases (TALENs) and transcription factors (TALE-TFs) for genome editing and transcription modulation applications...assembled into a Level 1 vector creating a single transcriptional unit (for example, a promoter, a 5' UTR, a ...E. coli to maintain the final plasmid after transformation. Figure 1: Overview of the MoClo Toolkit components...multigene constructs. MoClo Plant Parts III: Transformation & Genome Engineering Kit Plant Expression, ...several cassettes and generate multi-construct transgenic plants. GreenGate 2.0 Toolkit Plant Expression...components to create plasmids with multiple transcriptional units. MultiGreen Kit Plant Expression Wayne...
  11. Antibody Guide

    Type
    Guide
    ...proteins by size. Transfer proteins from the gel to a membrane. Incubate the membrane with an unconjugated...block the membrane to remove excess antibody and prevent unwanted binding. Incubate the membrane with a ...Wash and block the membrane. Activate the HRP with a substrate kit. Image the membrane using either X-ray...hybridoma cells into plasmids. Plasmids are then transfected into cells and induced to express antibodies....variable regions, shown in light blue and light orange, that bind to a specific antigen, triggering an...constant region, and is shown in dark blue and dark orange. The constant region is a stable part of the antibody...responsible for the variable region goes through a randomized reorganization process, creating a unique binding...
  12. Optogenetics Guide

    Type
    Guide
    ...generate two-part transcription factors, where Cry2 and CIB1 are fused to a transcriptional activation domain...and close when exposed to light and change the membrane potential, a behavior that can be harnessed for...trafficking signals to localize opsins to the cell membrane. Microbial opsins, such as those described below...conductance at physiological pH and traffics well to the membrane. The optogenetic toolbox has been expanded by ... exposure. OptoXRs and OptoGPCRs enable a broad range of pathways to be activated and explored, especially... from Kir2.1 and ER export signal for improved membrane targeting 589 Archaerhodopsins Name Description...kinase activity, localization, gene editing, transcriptional activation, and more. In addition to systems...
  13. Molecular Cloning Techniques

    Type
    Guide
    ...by certain bacteria and archaea, cleave double-stranded DNA (dsDNA) at specific sequence sites in the ...into fragments containing precise 5' or 3' single-strand overhangs (sticky ends), or no overhang (blunt ... They also cut specific target sequences, which range from four to 13 base pairs, and produce predictable... with four nicks that bacteria repair after transformation. LIC does not require site-specific recombination...exonuclease until a base is exposed on the single-strand overhang that is complementary to the free nucleotide... is rendered unnecessary. The product may be transformed directly into E. coli , where the normal replication... recombination abilities of yeast. By simply transforming into yeast two (or more) fragments of dsDNA ...
  14. Chemogenetics Guide

    Type
    Guide
    ...cell surface receptors, GPCRs are seven-pass transmembrane proteins that bind a specific ligand. Ligand...initiating signaling pathways in inflammation and neurotransmission. This, and the fact that GPCR ligands can ...in Japan, making it an attractive option for translational studies, however, it has off-target effects....hM4Di, and is especially attractive for use in translational studies because it is FDA- and EMA-approved....muscarinic Arrestin-2/-3 CNO Increase Arrestin translocation Arrestin signalling Nakajima & Wess, 2012 hM3Dq...j.neuron.2016.01.040 PMID: 26889809 Slaviero, A. N., Gorantla, N., Simkins, J., Crespo, E. L., Ikefuama, E. ... at the hM4D(Gi) DREADD amenable to clinical translation of chemogenetics. Sci Adv, 5 (4), eaaw1567. https...
  15. Sequencing Primers

    Type
    Guide
    ...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward SP6 ATTTAGGTGACACTATAG SP6 promoter Forward...recombinase Reverse CYC1 GCGTGAATGTAAGCGTGAC CYC1 transcriptioin termination signal/td> Reverse DsRed1-C AGCTGGACATCACCTCCCACAACG...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward pGP704-R AACAAGCCAGGGATGTAACG R6K gamma...Reverse Tn7-end GGGGTGGAAATGGAGTTTTT Bacteria transposon Tn7 Reverse? TRC-F CAAGGCTGTTAGAGAGATAATTGGA ...
  16. Educational Resources

    Type
    Guide
    ...protocols, our educational resources cover a wide range of topics in molecular biology, laboratory research...Protocols Find written and video protocols for a wide range of applications in molecular biology, plasmid cloning...virus, including: Gel Electrophoresis Bacterial Transformation Plasmid Cloning Creating Bacterial Glycerol...
  17. Addgene's eBook Collection

    Type
    Guide
    ...First Edition, trans. About CRISPR 101 en español January 2024 | First Edition, trans. About Una traducción...and management, resources for identifying your transferable skills, and tips on the job application process...
Showing: 1 - 17 of 17 results