We narrowed to 1,035 results for: LAS
-
TypeCollection...This page lists plasmid vectors designed to express nucleases in different cell types. Zinc finger arrays... Plasmid Collections Zinc Finger Consortium Nuclease Expression...Consortium: Nuclease Expression Vectors This page lists plasmid vectors designed to express nucleases in different...
-
Chemogenetics AAV Preps
TypeCollection... in specific cell types. See our Chemogenetics Plasmids and Chemogenetics Guide pages for more information...retrograde serotype, produced with the AAV retro helper plasmid from the Karpova and Schaffer labs. See the Retrograde...options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral vector prep you need.... -
Zinc Finger Consortium: Zinc Finger Arrays
TypeCollection... Plasmid Collections Zinc Finger Consortium Zinc Finger ...encoding zinc finger arrays should be cloned into plasmids also available through Addgene--the specific vector...OPEN gCTCCCAACCactttGCTGGTGTCa dopamine beta hydroxylase (dbh) OZ525 and OZ526 OPEN OPEN tCCCATCCTAtcgttGCATGAGCTc... -
Validated gRNA Sequences
TypeCollection...CRISPR experiments. This datatable is compiled from plasmids in Addgene's database as well as from sequences..., the categories described on Addgene's CRISPR Plasmids and Resources page have been used to indicate ...Datatable Target Gene Target Species Target Sequence Plasmid ID Application Cas9 Species PubMed ID Depositor...ACTTTAAAAGTATTCGCCAT 48656 cut T. denticola 24076762 Church UPRT Toxoplasma gondii GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes... -
Control AAV Preps
TypeCollection...We provide high quality AAV preps from select plasmids in the repository. Browse our control AAV collection...retrograde serotype, produced with the AAV retro helper plasmid from the Karpova and Schaffer labs. See the Retrograde...options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral vector prep you need.... -
Brain Armamentarium
TypeCollection... BRAIN Armamentarium Project below. Plasmids ID Plasmid Description PI Viral Preps ID Viral Prep Description...underlie behavior and network function. Browse plasmids or viral preps created with support from the BRAIN... -
AAV Molecular Tools
TypeCollection...Syn-driven, Cre-dependent Cre-dependent expression of cytoplasmic tdTomato and synaptophysin-EGFP for labeling ...options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral vector prep you need.... -
Addgene Packaged on Request: Scope of Service
TypeCollection...Transfer plasmids with sequence from the 5′ to the 3′ ITR exceeding 4.7 kb Transfer plasmids with a cargo... -
Biosensor AAV Preps
TypeCollection...retrograde serotype, produced with the AAV retro helper plasmid from the Karpova and Schaffer labs. See the Retrograde...options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral vector prep you need.... -
Tags and Other Markers
TypeCollection...? Check out our current collection of Antibody Plasmids , fill out our Suggest an Antibody form, or e-... -
Neuroscience
TypeCollection...? Check out our current collection of Antibody Plasmids , fill out our Suggest an Antibody form, or e-... -
NETRF
TypeCollection...others to join their cause. Browse the available plasmids from the NETRF-funded investigators listed below... -
AAV Viral Preps
TypeCollection... on Request service. You can choose a transfer plasmid from our repository and request packaging in one... -
AAV for Neuronal Tracing
TypeCollection...options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral vector prep you need.... -
TALENs for Endogenous Zebrafish Genes
TypeCollection...Pre-constructed pairs of TALEN plasmids targeting zebrafish genes....