We narrowed to 1,073 results for: TOR;

...For Pichia vectors with AOX1 terminator Reverse 5'AOX1 GACTGGTTCCAATTGACAAGC For Pichia vectors with AOX1... 5' of MCS in pBABE vectors Forward pBAD Forward ATGCCATAGCATTTTTATCC For vectors with E. coli araBAD ...For pBluescript vector Forward pBluescript SK TCTAGAACTAGTGGATC For pBluescript vector Reverse pGEX 3'...Actin 5C promoer Forward Alpha-factor TACTATTGCCAGCATTGCTGC Alpha factor signal sequence Forward Amp-R ...Pichia vectors with AUG1 promoter Forward AUG1 Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1...pAd-CMV vector Forward pBABE 3' ACCCTAACTGACACACATTCC SV40 enhancer, 3' of MCS in pBABE vectors Reverse...

...classes of base editors were cytosine base editors (purine-to-purine) and adenine base editors (pyrimidine-to-pyrimidine...base editors that can catalyze base transversions. These editors are based on cytosine base editors and...finger nucleases (ZFNs) or transcription-activator-like effector nucleases (TALENs) required scientists ...base editors, the evolved TadA domain is fused to Cas9n or dCas9 to create the adenine base editor. The...systems use a type V-K Cas effector, Cas12k. No matter the system, the Cas effectors lack nuclease activity...format into lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included...co-expression of epitope-tagged dCas9 and antibody-activator effector proteins; long-term imaging of proteins in...

...array vectors and destination vectors designed for use with the Golden Gate TALEN and TAL Effector Kit ...assembled into a Level 2 vector, forming a functional genetic circuit. Level 2 vectors are often designed with... CDSs, 9 terminators, 4 nonfunctional "dummy" parts, 34 backbones, and 6 destination vectors for use in...host range vectors compatible with the CIDAR MoClo cloning standard, including a combinatorial library of...Alistair McCormick Kit containing 96 parts and acceptor vectors for generating multi-part assemblies in either... and then combined by Gibson Assembly into acceptor vectors. The Mammalian Toolkit Mammalian Expression...MoClo system consists of three sets of cloning vectors (Level 0, 1, and 2) which can be used in successive...

...about viral vectors and their production, see our viral vector guides . Lentiviral vectors Lentiviral ...lentiviral preps . AAV vectors AAV vectors offer some advantages for viral vector delivery. Both lentiviral...Base editor (dCas9 or Cas9 nickase fusions with different base editing proteins) Many base editors fused...fusion with transcriptional activator (such as dCas9-VP64) Many different activator systems exist, including...base editors exert their functions within a limited window from the PAM sequence, and base editor variants...CRISPR protocols from Addgene depositors ). Browse empty gRNA expression vectors . Select Your Expression ... CRISPR plasmids . Delivery Using Viral Vectors Viral vectors are a great option, as they offer high expression...

...the RNA polymerase and transcription factors. Transcription factors are proteins which recruit RNA polymerase...by various DNA regulatory sequences, including enhancers, boundary elements, insulators, and silencers...sigma factors that assist the RNA polymerase in binding to the promoter region. Each sigma factor recognizes... RNA polymerase), an operator (a segment of DNA in which a repressor or activator can bind), and the structural...several transcription factors, and other accessory proteins (such as activators and structural proteins...also contains transcription factor binding sites, but mostly contains regulatory elements. Common Eukaryotic... Promoters are a vital component of expression vectors because they control the binding of the RNA polymerase...

...Depending on your answer, you'd pick an excitatory or inhibitory opsin, respectively. Color of activation...site of the viral vector, rather than in all cells. For example, using a viral vector with a floxed opsin...of optogenetics was considered to include both actuators (genetically-encoded tools for light-activated...overview, we will focus on the common optogenetic actuators used for optical control of proteins and cells...more information on biosensors such as calcium indicators or voltage sensors, visit our Biosensors Plasmid...physiological pH and traffics well to the membrane. Excitatory (Depolarizing) ChR Variants The optogenetic toolbox...VChR1, C1V1(t/t), Chrimson, ChrimsonR, Chronos Inhibitory (Hyperpolarizing) ChR Variants Alternatively,...

...antibodies can be stored at 4 °C for short-term storage. For long-term storage they should be stored at -20 °C... Antibody Handling Storage Check the manufacturer’s instructions for exact storage requirements. As a ...tips for storing your antibody: Antibodies conjugated to fluorophores should never be stored below 4 °... antibodies should not be stored in sodium azide, as it acts as an inhibitor to HRP. In those cases, thimerosal...define key terms, summarize antibody production and storage techniques, and explain common applications. Science...expensive than polyclonal antibodies. Environmental factors, binding partners, location in the cell, and sample... a primary antibody, which becomes the limiting factor for the number of proteins you can detect in a ...

...Commonly used cloning vectors include Gateway entry vectors and TOPO cloning vectors. Empty Backbones , ...study. Expression vectors must contain a promoter sequence, a transcription terminator sequence, and the...DLYDDDDK Thrombin LVPRGS BAD (Biotin Acceptor Domain) GLNDIFEAQKIEWHE Factor Xa IEGR or IDGR VSVG YTDIEMNRLGK...another, such as from a chromosome to a plasmid or vector DNA backbone. These tools are essential to the ...combination of a DNA fragment with a plasmid or vector DNA backbone generates a recombinant DNA molecule...can be replicated easily and efficiently in a laboratory setting. Are stable — Plasmids are stable long-term...facilitate the cloning of DNA fragments. Cloning vectors tend to be very simple, often containing only a...

...entry vector containing your DNA of interest (or obtained one of the thousands of entry vectors deposited...shuttled into any compatible Gateway destination vector, which contains attR sites, via LR clonase enzymes...a simple and efficient cloning method, Gateway vectors and recombination enzymes can be quite expensive...donor , Gateway entry , and Gateway destination vectors with different promoters, tags, selection markers...comes from a pre-cut, linear, cloning-ready TOPO vector that has a DNA topoisomerase I covalently bound...-ready, and it is not feasible to create a TOPO vector yourself. Additionally, the efficiency can vary...overhangs of 10–12 base pairs on the 5' end of both the vector and insert. These overhangs can easily anneal, ...

...viral vectors contains an introduction to each vector and its applications, tips for using vectors in your...Overlay Select Viral Vectors 101 July 2024 | Second Edition About Viral Vectors 101 July 2024 | ...protein; information on FRET, biosensors, and monitoring protein localization; an introduction to non-...the many career options in science, advice on mentoring and management, resources for identifying your...

... a wide range of topics in molecular biology, laboratory research, and career development. eBooks Download... Titles include: Plasmids 101 CRISPR 101 Viral Vectors 101 Fluorescent Proteins 101 Science Career Guide... How-to Blog Read about plasmids in Addgene’s repository , and related molecular biology techniques. Topics... Engineering Fluorescent Proteins CRISPR Viral Vectors Plasmid Technology Career Readiness Molecular Biology... Biology Learn about plasmids, sequencing, vectors, and restriction enzymes to assist with your molecular...

...engineered receptors to selectively control and investigate cell signaling pathways. Receptors are remotely...Chemogenetics CRISPR Optogenetics Pooled Libraries Viral Vectors Antibodies Produced by the immune system, antibodies...restricted to certain gene sets. Read More Viral Vectors Find educational guides to learn more about the...

...only a subset of genes, or very large (e.g., the Toronto KnockOut (TKO) library from the Moffat lab has ... to amplify the library, please refer to the depositor’s protocol for the best results. For some libraries...genome-wide screening with CRISPR/Cas9 . Browse our Viral Vector resources . Check out our blog posts featuring ...