Addgene

We narrowed to 233 results for: SPL

Showing: 151 - 180 of 233 results

Results per page:

Fluorescent Protein Travel Awards - FLiPs and Fluorescent Protein Biosensors

Type

Blog Post

...production of both types of HMO biosensors and displayed her findings at the Spring 2017 ACS meeting. She...
Quick Guide to Working with Drosophila Part 2: Controlling Gene Expression in Flies with Gal4/UAS

Type

Blog Post

...PMID: 28704652. 6. V. Rodríguez, D. Didiano, C. Desplan, Power tools for gene expression and clonal analysis...
The Power Behind NGS Plasmid Validation: seqWell

Type

Blog Post

...because the sample identity information is always displayed at the individual read level, and because custom...
Learning Technical Skills at a Lab Central Workshop

Type

Blog Post

...presentation describing the technology. Then we split into pairs to actually try out the kit itself. This...
Hot Plasmids - December 2019 - CRISPR pooled library, LipoGlo, CRISPRa, and Voltage Imaging Tools

Type

Blog Post

...amenable to use with other bEBP/UAS pairs, and displays high dynamic range. However, the promoter in question...
Fluorescent Protein Guide: Empty Backbones

Type

Collection

...Expression pBAD/His-B-iRFP - Bacterial Expression iSplit 690 713 5 Dimer pPAS-E - Mammalian Expression pK-GAFm...
Luminescent Imaging with Nano-lanterns

Type

Blog Post

...very robust, with an eNL-based calcium sensor displaying a 500% signal change upon calcium binding. Suzuki...
Screening for Successful Genome Editing with Digital PCR

Type

Blog Post

...below. Digital PCR Digital PCR (dPCR) involves splitting up a sample into thousands of physically isolated...
Choosing a CRISPR Nuclease: Site Accessibility, Specificity, and Sensitivity

Type

Blog Post

...David Liu Lab similarly described xCas9, which displayed the ability to target multiple PAM sequences (...
Targeted Mutagenesis with EvolvR

Type

Blog Post

...its native endonuclease activity degrades the displaced strand. Figure 1: EvolvR consists of ...
Hot Plasmids - May 2022

Type

Blog Post

...work, they have found at least two variants that display increased neuronal expression in the brain while...
Antibodies 101: ChIP

Type

Blog Post

...choose, you’ll need to reserve a small aliquot, split into two parts to (1) run a DNA gel to confirm fragment...
REPLACR Mutagenesis: Replacing In Vitro Recombination Methods

Type

Blog Post

...is also common. Overlap extension PCR is used to splice together two PCR amplicons based on sequence homology...
Choosing the B(right)est Fluorescent Protein: Photostability

Type

Blog Post

...top of photobleaching, fluorescent proteins may display reversible intensity changes (Shaner et al, 2008...
Transferable Skills Guide: Public Speaking

Type

Blog Post

...the nerve to do what I did. Until that panicked, split-second decision, I had always thought I had an obligation...
The time and cost required to make a plasmid

Type

Blog Post

...same time period. For ease of calculations*, let’s split the difference and put scientific inflation at… ...
CRISPR 101: Cas9 vs. The Other Cas(s)

Type

Blog Post

...cleavage and 2). cell toxicity. Cas7-11 does not display collateral RNA cleavage and is significantly less...
Hot Plasmids - March 2019 - Anti-CRISPR, 2in1 Cloning, Fluorescent Voltage Indicators, and Photoswitchable Proteins

Type

Blog Post

...the Uppalapati and Woolley lab developed a phage display technique using small scaffold proteins to identify...
Enhancing CRISPR Targeting Specificity with eSpCas9, SpCas9-HF1, & HypaCas9

Type

Blog Post

...SpCas9 N692A/M694A/Q695A/H698A). This new variant displays comparable on-target activity and similar or decreased...
Popular Retroviral Vectors and Their Uses in Scientific Research

Type

Blog Post

...purposes, retroviral vectors have been developed into ‘split-vector systems’ by separating viral genes and transgene...
Adeno Associated Virus (AAV) for Cell and Gene Therapy

Type

Blog Post

...direct evolution, capsid shuffling, and peptide displays. These capsids will be selected both for their...
Progress Towards a PAM-Free CRISPR

Type

Blog Post

... reliability. Notably, the SpRY variant didn’t display higher off-target effects than SpCas9, a pleasant...
Viral Vectors 101: Virus Safety

Type

Blog Post

...or face shields are required whenever there’s a splash or spray risk in BSL-1. In BSL-2 labs, eye protection...
Plasmids 101: In-house NGS Plasmid Quality Control Now at Addgene

Type

Blog Post

...chicken beta actin promoter, and rabbit beta-globin splice acceptor, contains sequence that is over 80% GC...
Nanoblades: Tiny CRISPR Ninjas for Genome Editing Difficult Cells

Type

Blog Post

...no detectable editing. Additionally, off-target spleen editing was not detected and Nanoblade injection...
Overcoming the Challenges of Lentiviral Production

Type

Blog Post

...reduced. Third generation packaging systems further split the viral genome by removing the viral Rev gene ...
Cpf1 Update: Comparison to Cas9 and NgAgo

Type

Blog Post

... cleavage. Now, two new studies show that Cpf1 displays lower off-target editing than Cas9, confirming...
Validated gRNA Sequences

Type

Collection

...GLuc synthetic GATCTAGATACGACTCACTAT 68422 CRISPR-display S. pyogenes 26030444 Rinn gp78 H. sapiens GCCCAGCCTCCGCACCTACA...
Magnetic Control of Proteins: More than a Dream

Type

Blog Post

...) and to see if any other fluorescent proteins display a similar effect (many do). Fusing EGFP to the ...
Of Myc and Men

Type

Blog Post

... E (2020) The Myc tag monoclonal antibody 9E10 displays highly variable epitope recognition dependent ...

Showing: 151 - 180 of 233 results

Results per page:

Fluorescent Protein Travel Awards - FLiPs and Fluorescent Protein Biosensors

Quick Guide to Working with Drosophila Part 2: Controlling Gene Expression in Flies with Gal4/UAS

The Power Behind NGS Plasmid Validation: seqWell

Learning Technical Skills at a Lab Central Workshop

Hot Plasmids - December 2019 - CRISPR pooled library, LipoGlo, CRISPRa, and Voltage Imaging Tools

Fluorescent Protein Guide: Empty Backbones

Luminescent Imaging with Nano-lanterns

Screening for Successful Genome Editing with Digital PCR

Choosing a CRISPR Nuclease: Site Accessibility, Specificity, and Sensitivity

Targeted Mutagenesis with EvolvR

Hot Plasmids - May 2022

Antibodies 101: ChIP

REPLACR Mutagenesis: Replacing In Vitro Recombination Methods

Choosing the B(right)est Fluorescent Protein: Photostability

Transferable Skills Guide: Public Speaking

The time and cost required to make a plasmid

CRISPR 101: Cas9 vs. The Other Cas(s)

Hot Plasmids - March 2019 - Anti-CRISPR, 2in1 Cloning, Fluorescent Voltage Indicators, and Photoswitchable Proteins

Enhancing CRISPR Targeting Specificity with eSpCas9, SpCas9-HF1, & HypaCas9

Popular Retroviral Vectors and Their Uses in Scientific Research

Adeno Associated Virus (AAV) for Cell and Gene Therapy

Progress Towards a PAM-Free CRISPR

Viral Vectors 101: Virus Safety

Plasmids 101: In-house NGS Plasmid Quality Control Now at Addgene

Nanoblades: Tiny CRISPR Ninjas for Genome Editing Difficult Cells

Overcoming the Challenges of Lentiviral Production

Cpf1 Update: Comparison to Cas9 and NgAgo

Validated gRNA Sequences

Magnetic Control of Proteins: More than a Dream

Of Myc and Men

Help Center

Deposit Plasmids

General Reagents

Viral Service

DNA Service

Plasmid Collections