We narrowed to 1,052 results for: FER

...be translated to other lines. Differences in the physiology of different cell types, however, can make...not only between serum from different manufacturers but also between different lots of serum from the same...low levels of contamination. For those labs that prefer a more economical mode of detection, Uphoff et....the second. When harvesting lentivirus, some labs prefer to collect and pool the harvests from multiple ...for a single harvest after transfecting with the transfer and packaging plasmids. A benefit of the multiple... as the transgene expressed, the viral storage buffers used, and other experimental parameters. For example...concentrated dilutions you will be able to overcome differences in receptor expression. It's all in the mix Even...

...converted to a different isotype, then two different secondary antibodies can be used with different fluorescent...have different binding properties (Morelock 1994). While in the majority of cases the differences are ...conversions and chimeric antibodies! References and resources References Liddell, E. (2013). Antibodies. In...changing an antibody’s natural isotype to that of a different group (Fig. 1). This process, called isotope conversion...antibody’s isotypes, however, you could then use 2 different secondaries for your antibody pair and visualize...constant regions or solely the Fc region of a different species and/or isotype (Liddell 2013). In most...

...dopamine sensors offer different levels of apparent dopamine affinity, with 113050 offering high apparent...these readily available to the community. We now offer AAV9 for 2 more constructs from Christopher Harvey... various AAV serotypes can be used to achieve different patterns of expression, researchers often need...empirically for their own experiments. To this end, we offer specific control AAV in smaller aliquots of 20 ul.... The Addgene viral service has now expanded to offer many of our control plasmids in new serotypes. See...sensitive response to action potentials, is now offered under control of the CAG promoter for ubiquitous...monitoring of neurotransmitters and we are excited to offer AAV for the newest GRAB sensors from the Li Lab....

...isotype is expressed at different times of the immune response and initiates different immune cascades. In...generates an antibody response in the immune system is referred to as an antigen. You can learn more about antibodies...In the research setting, antibodies of different isotypes can be used together in the same experiment ...of epitopes on the target protein, so they are referred to as polyclonal. Polyclonal antibodies have the...However, each animal will make antibodies against different protein epitopes and so variability between lots...molecular weight by SDS-PAGE, and are subsequently transferred to a membrane. A primary antibody recognizing...dissociated from the bead and the antibody using a low-pH buffer. Then, the purified protein can be used in experiments...

...experiment uses 2 or 3 different fluorescent colors each measuring a different target. Flow cytometers...analysis. Since different populations of immune cells express unique Clusters of Differentiation cell surface...flow cytometry experiments.       References and resources References: Bonner WA, Hulett HR, Sweet RG, ...  Cells are first resuspended in a pressurized buffer called sheath fluid and transported through tubes...each cell as it passes through and scatters in different directions. The degree of scatter is captured ...highly versatile and some can accommodate up to 30 different colors. This lends flow cytometry particularly...to complex experiments looking at a variety of different targets. If you are planning on using fluorescent...

...directions in your research. We all have our preferences. Your preferred type of CRISPR will likely depend on ...horizon (Altae-Tran et al., 2023)! References and Resources References Abudayyeh, O. O., Gootenberg, J. ...probably still edit genomes. Understanding the different types of CRISPR systems can be as confusing as...effector may have the same name but be completely different! They are merely linked by a similar function....Class 1 CRISPR systems use multi-Cas effectors, referred to as Cascade (CRISPR-associated complex for antiviral...compositions and mechanisms, with the biggest differences being the components present in the Cascade complex...like to explore Class 2 CRISPR in more depth, the Jennifer Doudna lab maintains an encyclopedia of Class ...

...subunit S12 of 30S ribosome Confers resistance to streptomycin Tn10   Confers resistance to tetracycline...coli bacteria. It’s hard to count the number of different commercial strains of E. coli currently available...the intestinal tract of animals. There are many different naturally occurring strains of E. coli, some of.... It was likely isolated in 1918 but was first referred to as “B strain” in 1942. The BL21 strain and ...F Host does (F') or does not (F-) contain the fertility plasmid. A low copy-number plasmid, encodes proteins...unless indicated otherwise fhuA (formerly tonA) ferric hydroxamate uptake, iron uptake receptor mutation...galactose only gyrA, gyrA96 DNA gyrase mutation Confers resistance to nalidixic acid  hsdRMS hsdR(rk-...

...duration of the conference (be warned, the hand sanitizer does go quickly!)  The Conference How many Addgenies... to brush up on your conference skills, check out some of our helpful conference blog posts before you...Scientific Conference Poster Session TipsHow to Make Friends and Meet People at a Scientific Conference New ...Getting ready for Society for Neuroscience Conference 2023? So are we! Come say hi to us at Addgene's...favorite content strategist, Jo. While we've all got different areas of expertise, we are each equally excited...invite you to join us! We'll also be sharing our conference experience on X, Instagram, and Bluesky.   Finally...

...performance under different imaging conditions (e.g. different emission filters) or different set-ups. Many...iii) aggregation tendency. Brightness Brightness refers to the fluorescence intensity of a fluorescent ...uptake by cells. To correct for this variation, a reference fluorescent protein that is expressed at an equal...be used. An assay developed in our lab uses a reference protein that is translated from the same open-...between the fluorescent protein of interest and the reference protein (Goedhart et al, 2011) allows for a precise... a set of fluorescent proteins (with the same reference protein) under identical conditions, a ranking...for co-expressing mTurquoise2 with mVenus as a reference protein is available from Addgene. Another way...

...discussed are compiled for reference below. Happy virus making!  References and Resources Kulanayake,...the delivered cargo (often a gene) is called the transfer plasmid while the other plasmids with packaging... or something similar, and is contained on the transfer plasmid. If expression is the goal, a promoter...promoter and terminator regions and are slightly different in sequence. Both LTRs do share common repeat ...Adeno-associated virus AAV’s elements are quite different from gamma-retrovirus, but they perform very similar...delivered and expressed in the host cell from the transfer plasmid. Viral packaging and entry The viral packaging...which allows for altered tropism of AAV to target different tissue or cell types. AAV also requires some back...

... activate different G proteins, work in different neurons and neuroglia, and have different effects on...Addgene’s chemogenetics guide.     References and resources References Kroeze WK, Sassano MF, Huang X-P,...These receptors can be activated by an array of different ligands, including hormones, neurotransmitters...is estimated that there are approximately 950 different human genes encoding GPCRs (Takeda et al., 2002...receptor, which can then activate expression of a luciferase reporter in the nucleus. The Roth lab showed ...activation via bioluminescence resonance energy transfer 2 (BRET2). Check out our blog post on GPCR signaling...track the activation and internalization of two different receptors- angiotensin II type 1 receptor and ...

...unaccounted for, may lead to different results. Different setting, different population, new genetic variation...obtaining a different result after conducting a replication study. An important difference between the...images, measuring the main outcomes in several different ways, and other questionable research practices..., simple noise in the process of sampling and inference-making. Even perfect transparent and rigorous ...variation, or different handling can all be important.  If we eliminate the problems above: unclear methods...previously unknown variable actually makes a big difference for the robustness of the findings.   How do...investigated to look for unexpected trends or differences between groups. Hypothesis generation is critical...

...for Neuroscience 2017 conference in Washington DC (#SfN17). This massive conference attracted over 30,000...-depth exposure to neuroscience prior to this conference was a rotation in Qiao Zhou’s lab in graduate...school where I worked on a project aiming to dedifferentiate mouse brain cells into neural stem cells. I...biologists. This was not at all the case. The conference featured people who work in sociology, behavior... Collider and which featured a talk about the different parts of the brain stimulated by stories. In retrospect...neuroscientists are using techniques from across different disciplines to better understand neurobiology ...develop technologies that will have impacts on many different facets of life. It also seems as if many of the...

...antibody’s buffer is compatible with your conjugation kit, since many common antibody buffers and buffer additives...are provided in a buffer with the antimicrobial agent sodium azide, which can interfere with conjugation...good base from which to dive deeper!References and resources References Bendall SC, Nolan GP, Roederer M,...love FPbase’s Spectra Viewer tool for comparing different fluorophores. We also touched on fluorophores ...chemical coupling can be achieved through several different mechanisms. Most take advantage of chemical groups... resources on the Addgene blog Antibodies 101: Buffers, Storage, and ConjugatesAntibodies 101: The Basics...

...everyone at this specific conference, and I was able to include and exclude different modules for this workshop...something about it. Building a diverse team with different talents and expertise Fortunately, the eLife ambassadors...realized that holding the next one at a scientific conference could potentially enable reproducibility practices...it physically to instruct the workshop at the conference, but because each contributor made the materials...open and modular nature of the workshop content: different parts could be mixed and matched to serve a specific...the lookout for upcoming workshops at future conferences this year. Workshops are confirmed for the Evolution... having a workshop organized at your upcoming conference or you’d like to join or contribute to this collaboration...

... Types of ELISA There are four different types of ELISAs, which differ in the way the antigen is detected... to run an ELISA in your lab!   References and resources References Boguszewska, K., Szewczuk, M., Urbaniak...Antibodies are used in many different experiments that require scientists to detect proteins in their...antibody and the detection antibody recognize different epitopes on the target protein, so they do not... for which multiple antibodies that recognize different epitopes are available; this type of ELISA is ... are coated with another protein — known as a reference antigen — that can also bind to that antibody....antigen as the other types of ELISAs require two different antibodies. As mentioned above, it can also be...

...reads are mapped against a reference sequence, if one was provided. If no reference is given, de novo assembly...functioning properly or be something completely different than what was originally intended. Sharing unverified...scientists worldwide. Depositing scientists provide different types of data for each of their plasmids, from...plasmid sequence de novo (without the use of a reference sequence) using a bioinformatics pipeline developed...scientists to easily visualize and identify sequence differences between our NGS results and deposited sequences...mismatches in significant plasmid elements. Which differences are considered a QC issue is reviewed yearly ...approaches to confirm plasmid sequences without a reference; and identifying mixed plasmid and nucleotide ...

...section, teams are assigned different groups of three genes selected from different parts of the Met pathway...first select a multi-gene pathway to study and a reference organism where deletion strains are available....Students next transform deletion strains from the reference organisms with the overexpression plasmids. Finally...species has a similar function to the gene in the reference species. We have been using yeast models (3, 4...yeast, Saccharomyces. cerevisiae, makes a great reference organism for the project because it is non-pathogenic.... Over time, the two genomes have become very different due to a whole genome duplication and extensive...cloning to insert the coding sequences for ten different MET/Met genes (Figure 1) from the two yeast species...

...drawbacks of different methods (for comprehensive protocols for all of the methods discussed here refer to Kutner...the correct transfer plasmid was used in the transfection; if preparing several different lentiviruses...assaying for expression of a gene carried on the transfer plasmid or quantifying the number of viral copies...resistance-genes, or the transgene itself. Many researchers prefer to design primers that target the common features...utilizes the antibiotic resistance genes carried on transfer plasmids. Target cells are transduced with serial...that standard conditions be used when comparing different batches of virus. In addition, some viral preps...step of a successful transduction experiment. References 1. Kutner, Robert H., Xian-Yang Zhang, and Jakob...

...to learn how to adapt to different situations and, in particular, to different styles of leadership. As... one gain such experience? Your institution may offer occasional workshops on leadership and management...to learn more. Having met many people at that conference, I later became involved with the NPA beyond ... the Committee which I then led for 5 years.  Different leadership styles Being an effective leader requires...requires you to understand how to work with many different types of people both above and below you. During...relationships with these individuals who often had different styles from their predecessors. Changes were implemented...mission of the NPA. You must accommodate many different types of people in order to harness their strengths...

... in mice Many systemic capsids express differently in different mouse strains, a phenomenon that we are...And these differences occur not just between mice and NHPs; some capsids show both different efficacy ... systemic capsids. After some consideration, we offer this definition: A systemic capsid is a capsid that...Organism Mouse Strain-Specific Tropism?  Reference AAV-PHP.B* CNS (broad) Mice, rats Yes...sex-independent and does not show significant differences in transduction efficiency between C57BL/6J and...transduction efficiency varying from 10-70% in different regions of the brain (Ravindra Kumar et al., 2020.../cJ and CBA/J mice. AAV1-X1 was developed by transferring the 7-mer peptide region from variable region...

... Educational Resources Molecular Biology Reference Promoters Promoters Prokaryotic Promoters Eukaryotic...mRNA transcript produced. The antisense strand is referred to as the template strand or noncoding strand,...transcription of DNA into mRNA. Promoter binding is very different in bacteria compared to eukaryotes. In bacteria...promoter region. Each sigma factor recognizes different core promoter sequences. Figure 2. Basic structure...regulation, like operons. Operons are a cluster of different genes that are controlled by a single promoter...can drive expression in specific cells or under different conditions. Promoter Expression Species Description... types of RNA polymerases that all transcribe different genes: RNA polymerase I — transcribes genes encoding...

...discomfort of the mice, and restraint method. Many different substances can be injected, including cells, drugs...through the tail vein — many researchers will simply refer to these as “tail vein injections.” However, they.... They are a popular choice for administering different drugs and viral vectors. Like IV injections, intraperitoneal...flat, and easily accessible (like the back) is preferred. A common use of intradermal injections is studying...techniques may come in handy. These techniques are referred to as “instillation” or “gavage,” as they do not...as both procedures target the lungs. The main differences are that intranasal is easier, less invasive,...be flexible or metal, depending on researcher preferences. It sounds complicated but has a pretty low learning...

...overlapping markers. Compensation/reference control(s) Compensation or “reference” controls are samples stained...spectral flow cytometry are more alike than they are different, there are a few aspects in which spectral flow...complex mathematical algorithm and single stained reference controls to distinguish one fluorophore from another...   Figure 3: Similarity index across 12 different colors on a three laser spectral flow cytometer...conventional or spectral flow. In spectral flow, reference controls tell the software to look for that exact...is not the same as your single color control. Reference controls: Beads or cells? Compensation beads are...new panel on a spectral cytometer, you prepare reference controls of both beads and cells for a single ...

... of the plasmids in our repository with known reference sequences, such as full plasmid sequences provided...BLAST, which includes a simple explanation of the different BLAST programs, databases, and elements of the...The blastp and blastx programs are optimized differently and you may want to select one (or both) depending...you want to verify. We will delve into these differences below. Optimizing blastn searches On the Standard... a Sanger sequencing result to a single known reference sequence or to a BLAST sequence database. If you...two or more sequences” checkbox and paste your reference sequence into the Subject Sequence box that appears...BLAST searches. If you do not know the exact reference sequence for your result, choose one of the BLAST...

...exact location of the TSS. Different databases annotate the TSS in different ways, and it has been shown...phenotype of interest. This blog post will discuss differences between these approaches, and provide updates...Doench et al., 2017, and Hanna et al., 2020) and references therein.   {% module_block module "widget_fcf9eab0...are so few gRNAs to choose from that sequence preferences must largely be ignored. Created with ...few potential gRNAs. While SpCas9, with a PAM preference of NGG, is still the most widely-used Cas enzyme...Cas12a enzymes, and engineered variants thereof offers additional PAM options that can greatly expand ... with BioRender.com. Two newer technologies offer an alternative to HDR for introducing edits. The...

... that differences in gene expression could explain why some ancestry groups were differentially dependent...ancestry-associated genes.   What does the reference genome actually reference?  The CRISPR guides used in the screens...done in this preprint.   Resources and references References Germline variation contributes to false... were designed to have a perfect match to the reference genome – even single mismatches within a CRISPR...introduce significant bias into the results. But the reference genome does not represent the diversity of genetic...understand how the use of a primarily European reference genome could affect their analysis. Their work...these and any other CRISPR screens using the same reference genomes and libraries. Further complicating the...

...Addgene blog Plasmid Preps: Different Purity, Different Quantities, Different Uses What's the Best Way to... our blog and website.          References and Resources References Ahlfen SV, Schlumpberger M. Effects...Each of these contaminants will have a slightly different impact on the spectra of a mixed sample.  ...A260/230 of ~2.0. However, let’s break down how different contaminants impact these ratios.  Protein contaminants...significantly at low concentrations.  The elution buffer you use will also affect how accurate your measurements...give more variable absorbance readings. A Tris-buffered solution tends to produce more consistent readings... instrument you use and check out some of the references we have provided below. And if you do have trouble...

... the split-luciferase system, intein-mediated splicing reconstitutes functional luciferase only when fusions...when separated (2), and that DBD and TAs from different systems could be combined effectively (3). In ...target gene, in this case a reporter gene (e.g. luciferase or GFP), regardless of whether it interacts with...sequence of the DBD. The DBD-POI fusion (commonly referred to as the “bait”, Figure 2b) cannot activate reporter...interact, this will bring the POI-TA fusion (commonly referred to as the “prey”) in close enough proximity to... fusions of the two halves of the luciferase protein interact and enable intein splicing (5). Screening...a more vigourous screen is to use a number of different bait and prey vectors. This has been shown to ...

...AGTCAAGTAACAACCGCGA 3' end of luciferase Forward LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase Reverse M13 Forward... Educational Resources Molecular Biology Reference Sequencing Primers Sequencing Primers Though Addgene...sequencing primers. These lists are provided for your reference, Addgene does not distribute primers. To identify...DNA, please consult Addgene's Molecular Biology Reference page . Universal Sequencing Primers Name Sequence...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward SP6 ATTTAGGTGACACTATAG SP6 promoter Forward...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward pGP704-R AACAAGCCAGGGATGTAACG R6K gamma...Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase Forward RVprimer3 CTAGCAAAATAGGCTGTCCC 5' of ...

... of the vectors in Addgene’s catalog are offered in different serotypes. In fact, the 879 viral vectors...these tools can be to use. AAVs, which can target different cell types depending on their serotype, are particularly...to researchers around the world. While we still offer many resources for producing vectors from plasmids...93,491 viral vector preps with researchers in 45 different countries — and as of 2024, we’ve distributed ... CRISPR, where we dove fairly deeply into the different types of tools scientists were using/depositing...prioritization happens for good reasons. We began offering our viral vector service because we realized that...successive generations developed ever since. GCaMP6 was offered through our viral vector service in 2016, and it...

...virus:  Lowering cytotoxicity. Different envelope proteins have different levels of cytotoxicity and the...Altering sensitivity to serum. Different pseudotyped viruses are differentially inactivated by nonspecific...Table 1 (Cronin et al., 2005)     References and Resources References: Crawford KHD, Eguia R, Dingens AS...protocol for generating lentivirus, but you use a different envelope glycoprotein instead of the wild-type...Lentiviral production uses three plasmids: (1) The transfer plasmid, (2) the envelope plasmid, and (3) the...review articles to find tables and information on different viral membranes, tropism, and advantages and disadvantages... Jennifer Tsang...

...experiments. The term ‘insert’ refers to plasmids carrying each part, ‘vector’ refers to acceptor plasmids, and...MoClo guide for all the basics of the process. Also refer to Figure 1 for a visual overview! Figure...vectors and parts you will be using during the different levels of your MoClo assembly. Know your process...dictated by four-base overhangs that are paired with different part types (e.g. 5’-GGAG and 3’-TACT flanking ...ensure that these would be interchangeable between different laboratories. Therefore, choosing acceptor vectors... Example Level 1 assembly. The choice between different Level 0 vectors depends on the four-base overhangs...MoClo plate, always do so in cold conditions and preferably on dry ice. Careful use of your glycerol stocks...

...protects against any of them. But different aminoglycosides work on different host species: kanamycin targets... unrelated host species, even from completely different kingdoms of life. That’s convenient for researchers...experiments in complex eukaryotic cells, but would prefer to grow, clone, and manipulate their vectors in...with BioRender.com. How are shuttle vectors different from other plasmids? If we all use the same molecular... Shuttle vectors have to address several big differences in the ways vectors are used across species: ...resistance gene on your vector might require two different selection molecules! It all depends on how the...Auxotrophic selection Another option is to use a different method of selection entirely. Auxotrophic selection...

...more stable than the methyltransferase. When a plasmid is lost, the methyltransferase is degraded and/or...of CcdB (toxin) and CcdA (antitoxin) where CcdB inferes with DNA replication by binding the GyrA subunit...composed of restriction endonucleases and methyltransferases. Restriction endonucleases cleave DNA at ...specific nucleotide sequences. To counter this, methyltransferases add methyl groups to bases at specific nucleotide...address a diverse set of biological inquiries. References Ogura, Teru, and Sota Hiraga. "Mini-F plasmid...genes that couple host cell division to plasmid proliferation." Proceedings of the National Academy of Sciences...Cara E., and James B. Kaper. "Use of stabilized luciferase-expressing plasmids to examine in vivo-induced...

...gene which differ between the AAV serotypes are responsible for serotype-specific differences in tissue...blog post to learn more about the AAV transfer plasmid! References: Naso MF, Tomkowicz B, Perry WL III...proteins needed for the virus to replicate,  and the transfer plasmid which contains the viral genome. In today... proteins. Alternative splicing generates the different C-terminal regions of the Rep proteins. While ...Replication initiates from the AAV genome ITRs on the transfer plasmid, which contain regions of dsDNA. To generate...the AAV p40 promoter. Alternative splicing and differing translational start sites generate the three VP...was engineered Learn about the parts of the AAV transfer plasmid  Resources on Addgene.org Learn about...

...Administration of Substrate: Some luciferase reporters, such as Renilla luciferase (RLuc) or NanoLuc, require...bacterial reporters that use fluorophores and luciferases to track bacteria in real time, but each of these...together genes from gas vesicle operons from two different bacteria, Bourdeau et al created two constructs... 1 (arg1) and acoustic gene 2 (arg2). The key difference between arg1 and arg2 vesicles is the amount ... invisible to ultrasound, which allows for differentiation of arg1 and arg2 ultrasound signals. This also...and arg2 plasmids are available from Addgene! References 1 Bourdeau, R.W., Lee-Gosselin, A., Lakshmanan...Blog Learn more about in vivo imaging tools The luciferase reporter gene The green fluorescent protein reporter...

...Direct reprogramming describes the process where differentiated cells are turned into a cell type of choice...identifier and allows cells to be tagged with different CellTag libraries at multiple timepoints during... (iEPs), a self-renewing cell type that can differentiate into hepatic or intestinal cell types. MEFs ...inefficient. Cells were sequentially tagged with different CellTag libraries at three time points during ...MettI7a1 encodes an uncharacterized putative methyltransferase. Adding Mettl7a1 to the standard Foxa1-Hnf4α...are undergoing identity changes, such as the differentiation of induced pluripotent stem cells or the clonal...visualization tool. Check out the CellTag webpage! References Biddy, Brent A., et al. "Single-cell mapping ...

...19 pandemic,” says Balazs.     References and Resources References Cele S, Gazy I, Jackson L, Hwa S-...neutralization effectiveness of current vaccines differed depending on the variants (Garcia-Beltran et al...plasmids which encode spikes found on all of the different circulating variants. This allowed us to create.... In their assay, the pseudoviruses express a luciferase reporter which is used as a readout for infection...variants. Yet, the B.1.351 variant, which has only 9 different mutations compared to the wild-type, escaped neutralization...Garcia-Beltran et al., 2021 with permission.   Difference in neutralization after one dose and two doses..., this study was the first to compare so many different strains. It was also the first to perform neutralization...

...have risen into yeast expertise! References and Resources References Liu, Wei, et al., From Saccharomyces...applications in food science and biotech due to its fermentation abilities and other useful traits. The “biotech...lists some of the biological commonalities and differences between K. phaffii and other yeast strains.   ...aerobe Number of chromosomes 16 3 4 Preferred carbon source Glucose Glucose Glucose, methanol...Applications for K. phaffii There’s a number of different uses for the phaffii-lous strain. Protein expression...peroxisome studies since their peroxisomes will proliferate upon a media change into methanol and peroxisomal...peroxisomal studies on biogenesis, degradation, and proliferation. Genome manipulation K. phaffii’s genome has...

...add loading buffer to your digest reactions before loading them. The glycerol in the buffer will make sure...based on the predicted sizes and organization of different features within the plasmid. Restriction analysis...can search NCBI for YGOI to find the particular reference sequence if necessary. The example plasmid on ...fragment having increased intensity to serve as a reference band. The uncut DNA (lane 2) shows 3 possible ...visualize the full size of your construct. Consider buffer and temperature compatibility when digesting with...versions of the endonucleases and/or supply custom buffers as means to avoid this issue. For your gel: ...in the gel well and the dyes provide a visual reference point so you can easily assess how far the gel...

...skills that were quite different from mine. Learning to bridge those differences was a pivotal moment in...technical problems in the lab, management involves a different skill set: mentoring, setting strategic goals,... day-to-day details. Ignoring individual differencesManaging a team isn’t “one size fits all”. Each team... needs. For instance, I had one colleague who preferred detailed instructions and regular check-ins, which...autonomously. Failing to recognize and adapt to these differences could have led to frustration, micromanagement... particular, served as a great "baby project," offering a supportive environment to build my management...noticed tension between two team members with differing approaches—one detail-focused and the other big-picture...

...imaging for advanced monitoring of different factors, in different or the same cellular location, all ...covered with packaging plasmids! References and Resources References  Bhalla N., Jolly P., et al. Introduction...biosensors provide quantifiable readouts for levels of different chemicals, hormones, proteins, etc., that you ...as calcium. This varied component, which we will refer to as the analyte, needs to be specifically recognized...and zinc. These ion sensors can be targeted to different cellular locations or tissues depending on the...acceptor of a FRET pair on actinin will produce different signals based on changes to the structure of actinin...organisms, but AAVs make it possible. In AAV systems, different serotypes can be used to affect or determine viral...

...antibodies differ from other types of antibodies? How monoclonal antibodies are made “Monoclonal” refers to ...for your experimental needs.     References and resources References Bradbury ARM, Trinklein ND, Thie ...experiments, you may be curious about all of the different kinds of antibodies that are available. One common...heterogenous mixture of antibodies that recognize many different epitopes on the same protein - are more likely...to produce monoclonal antibodies. Genetic drift refers to changes in the nucleic acid sequence of the ...impacts the specificity, avidity, and number of different antibodies produced by the hybridoma. Image from..., Aldred SF, Bestagno M, Burrone O, Maynard J, Ferrara F, Trimmer JS, Görnemann J, Glanville J, Wolf P...

...in. The differences They say the devil is in the details - and that’s where the differences in these... RNAi resources and go fishing! References and resources References Wang, T., Wei, J.J., Sabatini, D....? If you’re thinking, ‘wait, those terms mean different things?!’, you aren’t alone! We’ve noticed a lot...selections The common goals The confusion in differentiating between a screen and a selection isn’t surprising... you would individually treat cells with many different drugs and then perform an assay to look at an ...enhancer/suppressor screens. Selections Selections differ from screens in that only survivable manipulations...experimental question. Now that you understand the difference between the two, it’s time to check out our CRISPR...

...excitatory and inhibitory channels activated at different wavelengths of light (Vierock et al., 2021). Step-function...stay on until a second pulse of light, with a different wavelength, turns it off, allowing the cell to... secondary signaling pathways. There are many different opsin (natural and engineered proteins responsive...pathway to activate various protein regulators at different points in the pathway. Photoswitches are great...successive steps along a pathway, there can be very different responses to long vs. short stimulation times ... & Cui, 2015). You’ll need to test for these differences when designing your experiment.  Finding the ...available to help light your path! Resources and references Recommended reading Abreu, N., & Levitz, J. (...

...’s of working in different sectors. Luckily, I have worked for a variety of different organizations, so...overview of my experience and how I felt about the different positions to enable them to decide for themselves...effectively. I had to learn how to cope with a different climate and culture, and also needed to be resourceful...very quickly; as soon as I learned how to do the different tests and became efficient, I then started to ...diagnostic tool for the detection and diagnosis of different types of pancreatic cancer and highlighting which...were keen for me to become involved with many different aspects of the company and gave me the freedom... and travel to meet scientists, making my job different every day. I love the freedom to design and develop...

...international mentoring conference held at the University of Valencia (Spain). At this conference, mentors and mentees...professional development and networking resources offered by programs like IMP USA-Europe not only provide...international mentors. Universities from five different geographical locations in Spain were enrolled:...mentees held scheduled monthly progress video conferences and had real-time correspondence via e-mail throughout...Mentorship Program and the International Mentorship Conference In addition to a pre-program self-assessment ... exchanged impressions of the IMP experience. Conference highlights included remarks by the Spanish Secretary...community overseas. Official representatives from different Spanish universities and high level public and...

... interest is then eluted using a high imidazole buffer that outcompetes the interaction between the protein...contaminating protein (orange). A low imidazole wash buffer disrupts the weak interaction of the contaminating...the protein of interest. A high imidazole elution buffer disrupts the interaction of the protein of interest...step to remove the tag in order to prevent it interfering with protein function. In contrast, the polyhistidine...The concentration of imidazole used in the wash buffer should be high enough to disrupt contaminant-metal... of a protein. Neither the N or C terminus is preferable over the other however, tag placement can affect... it is, and the greater the risk that it will interfere with protein function.  Additional Benefits of...

...ganglia in movement disorders.   References and Resources References Armbruster BN, Li X, Pausch MH, Herlitze... be the best option. Fluorescent proteins can interfere with fused protein function Under some circumstances...found that the fluorescent proteins can, indeed, interfere with the correct function of the protein of interest...in monkey neurons, we next hypothesized that a different tag fused to the hM4Di might improve the transport...Surprisingly, we found that this small change made a big difference. Replacing the mCherry with the HA tag resulted...transgene of interest. In our studies, mCherry interfered with the transport to the membrane of the DREADDs...doi.org/10.1002/0471140864.ps0909s73 Additional references on the Addgene blog Browse Fluorescent 101 blog...