...Publication Prime Edit Cas9 H840A nickase fused to a reverse transcriptase (RT) is capable of installing targeted...

...vectors for human gene therapy of glaucoma and their reversed cell entry characteristics. Gene Ther . 2020 Apr...

...Locus-specific ChIP combined with NGS analysis reveals genomic regulatory regions that physically interact...

...110,139 unique DNA sequences corresponding to every previously observed instance of human serine phosphorylation...

...the N terminus of the wild-type TALE protein (previously shown to preserve the DNA-binding ability of ...

...bacteria ( E. coli, B. subtilis ), yeast ( S. cerevisiae ), worm ( C. elegans ), fruit fly, zebrafish,...

...TTATTAGGCACTTTTTTGtaaacgctgtattccaTGCACTTTCCTGTCCACA tetmethylcytosinedioxygenase 3 (previous si:ch211-220a11.1) TAL3576 & TAL3577 TCAAATCCTGAATCTCAAcaaggtgtttggagtgGTCAAAATGCCAGCACAA...

...primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Why does the PX260 plasmid...

...the gRNA vector you have chosen, so it is best to review the protocol associated with the specific plasmid...

...-Expressing GABAergic Neurons in Barrel Cortex Reveals Local and Long-Range Circuit Motifs. Cell Rep. ...

...periplasm which may aid disulfide bond formation or prevent toxicity. Compatible with Gateway cloning. pGTvL1...

... replication. 5’LTR 5’ long terminal repeat. RRE Rev response element. A.3 Related Products The following... RNA polymerase III. Note that these were the prevailing guidelines when the pLKO.1 vector was created...CCGG—21bp sense—CTCGAG—21bp antisense—TTTTTG 3’ Reverse oligo: 5’ AATTCAAAAA—21bp sense—CTCGAG...AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT TTTTTG 3’ Reverse oligo: 5’ AATTCAAAAA AATGCCTACGTTAAGCTATAC...the sticky ends of EcoRI and AgeI. Forward and reverse oligos are annealed and ligated into the pLKO.1...concentration of 20 μM, then mix: 5 μL Forward oligo 5 μL Reverse oligo 5 μL 10x NEB buffer 2 35 μL ddH 2 O Incubate...TRC Cloning Vector The following steps were the prevailing guidelines when the pLKO.1 vector was created...

...2009. PubMed PMID: 19633652 Court, et al. Annu Rev Genet. 2002. PubMed PMID: 12429697 Lajoie, et al...this screen the authors were able to identify 7 previously unsuspected genes with known roles in ER-associated... fitness-related genes than have been found in previous screens of this type. They were also able to functionally...backward compatible with all TAL effector scaffolds previously constructed for the Golden Gate TALEN and TAL..., SnoopTag/SnoopCatcher, that can be used to irreversibly link desired proteins together via a spontaneous...isopeptide bond. When used in combination with their previously described SpyTag/SpyCatcher pair, multiple protein... industry, depend on the yeast, Saccharomyces cerevisiae, as a key host for the production of their products...

...submit it to a journal that uses a peer review system. Peer review in traditional journals happens before...blind (meaning you don’t know who the reviewers are). If the reviewers and the editor decide that your manuscript...several rounds of revision before acceptance. F1000Research uses a novel form of peer review that occurs post-publication...referee reports. If the reviewers suggest that the manuscript requires revisions, the authors can publish...is a relatively new development, and it allows reviewers and other researchers to access the data and make...and reliability of science publications. Peer reviewing To make sure your manuscript is perceived as a...manuscript needs to be revised before it can be published, this can delay publication and manuscripts ...

...them! PE2: Improving reverse transcriptase efficiency Building upon prior reverse transcriptase research...humans and cataloged in the ClinVar database. Previously developed genome editing methods using nucleases...prime editor consists of a Cas9 nickase fused to a reverse transcriptase. The Cas9 nickase is guided to the...sequence hybridizes to the target site, and the reverse transcriptase domain copies the desired edit, directly...wild-type Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase to the C-terminus of Cas9 H840A nickase...every ~8 base pairs on either DNA strand, many previously developed base editors with a <8 base-pair editing...the edit, the Liu lab turned to a strategy they previously used when they developed base editing. By nicking...

...systems reviewed here. The only required components are 1) a SMASh-tagged protein and 2) asunaprevir (small...and exogenously expressed proteins. Here we will review what advantages degron tags can offer over other...systems – CRISPR, siRNA, etc. Firstly, they are reversible mechanisms of control. Protein degradation can...the drug has been removed. The degradation and reversal are rapid compared to other systems because the...comes to degrons, you have options! Below we will review the 4 most common types of degrons and some of ...the presence of a specific protease inhibitor, asunaprevir, the viral protease can no longer self-cleave...addition to having the coolest name of all the tags reviewed here, the SMASh tag does offer a few other unique...

...formal peer review. Some organizations, including some journals, also support open peer review or curation... peer review itself can be prone to biases or errors, with a lack of transparency in most review processes...authors on a public server independent from peer-reviewed publishing in a journal.  Accelerating Scientific...scientists and advocates have argued that while peer review is valuable, modern scientific publishing has a...or endorsements. In contrast, journal-based peer review is usually a confidential process among a few individuals...productivity that can be shared with hiring and review committees, as opposed to the opaque (and, admittedly...preprints, and a growing number of funding bodies and review committees encourage and consider preprints as ...

...L-hisitidine no S. cerevisiae  no yes   URA3 pyrimidine (uracil) yes - Grow with 5-FOA. S. cerevisiae yes - This...of a nitrogen source. S. cerevisiae  no no   LEU2 L-leucine no S. cerevisiae yes - This can complement...explain how they differ from the bacterial elements previously described. Why do scientists use yeast vectors...pertains to ORIs in budding yeast, Saccharomyces cerevisiae; however, we’ve also noted some features required...Schizosaccharomyces pombe, vectors at the end.) In a previous post, we briefly discussed how the regulation ...if specific regulatable elements are included (reviewed here). Plasmids for use in S. pombe, on the other... TRP1 L-tryptophan yes - Grow with 5-FAA. S. cerevisiae no  no TRP1 alters some yeast phenotypes. This...

...publication of peer reviews so we can see how and why papers change throughout the review process. This will...reproducibility. Cause 1: Inability to repeat previously performed experiments Researchers should be able...incredibly useful technique simply by following the abbreviated methods section found within a published manuscript...additionally averse to producing papers that repeat previously published results. This over-reliance on the ...will hopefully push reviewers towards more productive criticisms that focus less on perceived novelty ...recognizing that we’re biased and taking steps to prevent our biases and goals from effecting our experiments...things I’ve read comes to this: we need others to review our experimental designs and we need to be transparent...

...and it grows fast to boot. The yeast strains S. cerevisiae and S. pombe have dominated the research scene...are there even other yeasts? In this blog we will review an alternative model yeast strain and discuss why...used yeast strains: S. pombe (fission) and S. cerevisiae (budding). Yeast make for an excellent model ...genetic manipulation The first eukaryote (S. cerevisiae) to have its genome fully sequenced There are...wondering if the “biotech yeast” is S. pombe or S. cerevisiae. Actually, it’s neither. The most commonly used...phaffii and other yeast strains.     S. cerevisiae S. pombe K. phaffii Growth properties... is only distantly related to S. pombe and S. cerevisiae; evolutionarily it evolved much slower and bears...