...to allow for antibodies to enter the cell (Figure 3). A useful side effect of the fixing/permeabilization...cytosolic procedure in that case.     Figure 3: For intracellular labeling cells need to be fixed..., you may want to look at other methods. In the above cases, a good alternative is using a two-protein... region of the primary antibody (Figure 1b). As above, the advantage of this system is increased flexibility...

... it from carrying out its proper function (Figure 3).  The Hehnly Lab used such a strategy to dissect ...injection of plasmids and other materials.    Figure 3: Optogenetic inhibition of Rab protein vesicle trafficking... Check out our Optogenetics Guide to learn more about how these modules work, and read on to learn how...to the cell membrane isn’t powerful enough, what about altering the chemical composition of the membrane...

... et al. designed gRNAs to target the HIV-1 5’ and 3’ LTRs and expressed them along with Cas9 in the T-...eradicating HIV-1/AIDS. J Neurovirol. 2015 Jun;21(3):310-21. PubMed PMID: 25716921. Additional Resources...reservoirs, chronic inflammation, and negative metabolic effects of ART. Why can’t the body mount an immune...

...Blog (other programs are discussed below). Chpater 3: SITN Popularity and Events - Amy discusses some of...To learn more about the STIN's podcast, email [email protected]    For more info about starting your...evens where scientists can grab a beer and chat about their work at a local bar. It doesn't have to be...1: Introduction - Vini and Amy tell us a little about themselves. Chapter 2: What is Science in the News...science communicators. In this chapter we learn about some of their events - science seminars, science...the lab and working with SITN. She points to collaboration and delegating as keys achieving success. Chapter...your own SciComm organization and to learn about some of SITN's other initiatives, email [email protected]...

...for making scientific graphics. PS: they’re free. 3. Fluorescent Proteins 101: GFP Fusion Proteins - Making...mNeonGreen, mTFP1, and mWasabi by Jennifer Tsang Learn about mNeonGreen, mTFP1, and mWasabi and find plasmids...Broccoli, Spinach, and Corn, for example. Learn more about the aptamer soup in this blog post. 5. Five Popular...

...similarly but not identically to BE3, modifying a 3-5 base window 18 bases upstream of the PAM.  David...than BE2 Nishida et al., 2016 Target-AID   Edits 3-5 base window surrounding -18 position upstream of... efficiency and product purity. Science Advances, 3(8), eaao4774. https://doi.org/10.1126/sciadv.aao4774...Homology-Directed Repair Learn about base editing for plants Read about four base editor reporters Additional... The BE3 system increased editing frequency to above 30% for a variety of targets in human cell lines... Liu lab created BE4max and AncBE4max mentioned above, they also made an adenine base editor with improved...cell therapy applications. Dual base editors What about combining the function of both editors into one?...

...the human kinome. These plasmids contain the same 3-4 gRNAs found in the first subset of the pooled library...numbers that’ll leave you, well, #sad. Learn More About CRISPR Pooled Library Screening Why the kinome?...

... bar to quickly find what you’re looking for. Tip 3: Share protocols and spreadsheets with lab members...experiments before the next R01 is due. But what about organizing yourself and your lab? Organizing your...

...tissue-penetrating wavelength above 600 nm. LumiFluors Schaub, F.X., et al. (3) designed two imaging probes...PMID: 27465542. PubMed Central PMCID: PMC4974478. 3. Schaub, F.X., et al. (2015) Fluorophore-NanoLuc BRET...Blog Learn more about FRET Tips for Using FRET in Your Experiments Learn more about Fluorescent Protein...heme-containing proteins in whole animals, light at or above 600 nm wavelengths should be used. Researchers often...be excited by NanoLuc® luciferase (NLuc) and set about to create an in vivo imaging reporter by linking...

...For treatment, it is best to identify a cocktail of 3-12 phages. Once these phages are identified, they ...open science Find blog posts about scientific sharing Find blog posts about networking Additional resources...

... Transcriptional repression DNA Methyltransferase 3 Alpha (DNMT3A) Vlatka Zoldoš’ lab has deposited pdCas9...available as ready-to-use lentivirus. Figure 3: dCas9-DNMT3A methylates cytosines at promoters and...modifications. Like the TALE-LSD1 system described above, dCas9-LSD1 inactivates targeted enhancers. Although...setting up your experimental system. Let us know about your experience with these constructs in the comments...

... leaving behind any accessory DNA sequences [2], [3]. Simply put, the piggyBac™ transposon containing ...PMID: 26702451. PubMed Central PMCID: PMC4686154. 3. A. M. Singh, D. W. Perry, V. V. A. Steffey, K. Miller...transposase itself, please read on to learn more about this exciting technology from the folks at Transposagen...Additional Resources on the Addgene Blog Learn about the Sleeping Beauty Transposase Read up on Genome...

...variants. Klapoetke et al., Nat Methods 2014 Mar 11;(3):338-46. For more information and descriptions of...counterparts. The Janovjak lab has deposited their 3 Opto-RTK constructs – Opto-mFGFR1, Opto-hEGFR, and...turn green. Mashiko et al., Sci Rep 2013 Nov 27; 3:3355. Rinehart lab reagents for improved expression...96-102. Druckmann et al., Neuron. 2014. Feb 5;81(3):629-40.  Next-Gen Brainbow toolkit for neuronal...2012 Mar 20;109(12):E690-7. For further reading about SpyLigase technology, read the Addgene interview...; DOI: 10.1021/sb4001504. For further reading about Nicola Patron's MoClo kit and her plant synbio research...in optimizing TALEN assembly and activity? The laboratory of Takashi Yamamoto has created a complete TALEN...

...be automatically adjusted every 3 years. In May 2016, Secretary of Labor Thomas Perez updated the overtime...the Addgene Blog How did this change in labor laws come about? In March 2014, the White House issued a...must be above this level, and certain job duty tests must be met. In the Department of Labor’s general... to $47,476 per year, under updates to the Fair Labor Standards Act (FLSA). This is having a major effect...ensuring that either all affected scientists are paid above this threshold or for tracking the hours that these... a memorandum to the Secretary of Labor to update the FLSA, which had not seen revisions since 2004. In... In July 2015, the Department of Labor issued a Notice of Proposed Rulemaking, soliciting feedback by ...

...Tris-acetate 40–500 kDa Tris-tricine 150 V, 1–3 hours Good for higher weight proteins Long running...very large proteins. A semi-dry transfer is faster — 3–30 minutes — and uses less buffer, but it is not as...approaches best suit your experimental needs. Table 3: Optimizing the technical design of a western blot...If you’ve ever run a western blot, or thought about running one, you’ll know there’s a lot of choices...

...cyanobacterium Vampirovibrio chlorellavorus." PeerJ 3 (2015): e968. PubMed PMID: 26038723. PubMed Central... Additional resources on the Addgene blog Read about company culture at Addgene See some of our previous...

...for more on timely submission of a job application. 3) Read job descriptions carefully Be open minded and... your strengths in your resume and don't be shy about asking for help. The worst thing that can happen...

...to wash Eppendorf tubes which were to be used for 3 months before they could be discarded.  Seeding Labs...Reddit AMA  Few of us spend much time thinking about conserving resources in the labs. Disposable plastic...Dudnik, Founder of Seeding Labs, tells the story about working as a student in a rice lab in the Ivory ...didn’t feel the need to reuse plasticware or think about conserving reagents and buffers.  However, I had...environmentally conscious friends who had me thinking about energy conservation even before it was a popular...Turns out, one could make a lifetime supply for about $10 US dollars worth of glass powder pruchased from...So, I designed my own gel box (see illustration above) and bribed the guys in the hospital machine shop...

...it doesn’t help much if the actual response takes 3 days and still doesn’t even answer your question. ...not even get a solution to the problem you called about. Next, you try an email, given that this is the ...” next to an encircled question mark (see image above). This useful widget allows you to access our Help... or you just have a general question or concern about the answers we provide, within the widget you also...Addgene Blog Read other Inside Addgene Posts Learn about New Features on Our Plasmid Pages Resources at ...

...plasmid, which contain regions of dsDNA. To generate a 3’ hydroxyl group needed for DNA replication, Rep78/...engineered Learn about the parts of the AAV transfer plasmid  Resources on Addgene.org Learn about AAV Find ...plasmid! Check out this blog post to learn more about the AAV transfer plasmid! References: Naso MF...

...C-terminus (3xHA, 13xMyc, GST, or GFP). Longtine et al.(3) describe a complimentary set of plasmids for use ...strain. In addition to the collections featured above, many other modular yeast tagging systems have been...Addgene would love to hear from you, our community, about your experience with yeast genome modifications....

... ways we get your plasmids out there Beyond these 3 big pushes, we try to increase your work’s visibility... will be able to easily find the fruits of your labor and won’t have to repeat the modification. This ...re ever interested in writing your own blog post about a plasmid or set of plasmids you’ve deposited with...

... cells, as well as in cortical neurons in layer 2/3 of the mouse brain. Rubin’s work shows that the yeast...site-specific recombination in Drosophila, read on to learn about new recombinases suitable for this system. Gerald...recombinases from the Rubin lab For more information about limitations and caveats of Cre usage: Vagaries of...

... term sgRNA. Seed sequence: The 8-10 bases on the 3’ end of an RNA guide (either crRNA or sgRNA). Cas9...used to target complementary DNA sequences. In laboratory settings, an sgRNA includes the crRNA and tracrRNA...itself, simplifying the CRISPR-Cas9 system for laboratory applications. At Addgene, we sometimes refer ...

...for particular screens of interest.   Figure 3: Each publication featured in BioGRID ORCS has a dedicated...resources on the Addgene blog Read this blog post about genome-wide screening using CRISPR Find all of our...on Addgene.org Read our CRISPR guide Learn more about plasmid pooled libraries Find CRISPR plasmids for...

...community. These popular plasmids are categorized into a 3-level system on our website:   A yellow flame indicates...Flame awardee Sophien Kamoun of the Sainsbury Laboratory in Norwich, UK: “We’re very pleased to distribute...Plasmid in 2015 Find Hot Plasmid Technologies Write about Your Favorite Plasmid Technology Resources on Addgene.org...

...Halorhodopsin plasmids . Archaerhodopsins Archaerhodopsin-3 (Arch) from Halorubrum sodomense is also commonly ...with single-spike temporal resolution. PLoS One. 2(3):e299. PMID 17375185 Kim B, Lin MZ. 2013. Optobiology...excitation of distinct neural populations. Nat Methods. 11(3):338-46. PMID 24509633 Lin, J. 2011. A User’s Guide...control of neural activity. Cold Spring Harb Protoc. 3:top102. PMID 21363959 Yizhar O, Fenno LE, Prigge M...derived from Volvox carteri. Nat Neurosci. 11(6):631-3. PMID 18432196... to permit CIB1 binding. As shown in the figure above, this light induced binding can be utilized to control...dimerization. In addition to the applications described above, both LOV and Dronpa can control activity of a fused...

...' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo: 3' - GTATAC AATTAATT CCGCGCGG GTTAAC - ...To do this, we add 5' - AATTC and G - 3' to the top oligo and 3' - G and CAGCT - 5' to the bottom oligo...AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3' - G GTATAC AATTAATT CCGCGCGG GTTAAC CAGCT...AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3' Note: If you plan to...CAGCT - 5' Note: We could leave off the 3’ G on each oligo (and the complementary C of the other oligo),...tube. Place tube in 90-95°C hot block and leave for 3-5 minutes. Remove the hot block from the heat source...vector in molar ratios (vector:insert) between 4:3 and 1:6 in a standard ligation reaction (ex. to ligate ...

...Furthermore, Group Leader position applications require 3 letters of reference- the graduate school mentor, ...yourself to and talk with more senior scientists. 3. Work intensely, but intelligently Before you do your...Nature and Science, for example). This blog post is about how to get the most out of your postdoctoral training...your new model?  PFs need to be regularly thinking about manuscripts. The other items will follow. If you...this is a strong indicator that this person cares about your science and your development. Taken together...Researchers face a fundamental conflict. Science is about exploration, discovering new information. There ...many PFs are reluctant to give talks or posters about their research. They dread giving a departmental...

...fluorescent protein. Nat Methods. 2009 Feb 6(2):131-3.  PubMed. Find plasmids from this publication at...this protein has a few more secrets - during a collaboration, members of Maureen Hanson’s and Rima Menassa's...

... 6–8 weeks Average shipping time: 1–2 days (USA); 3–4 days (international; varies widely by country and...educational resources.  We hope you’re as excited about this expansion as we are! Happy packaging! ...

...fluorescent proteins. Krumholz et al (Sci Rep. 2014 Feb 3; 4:3939. doi: 10.1038/srep03939.)  ... absorbance of water, which absorbs wavelengths above 900 nm or so. In other words, wavelengths between...

...gene expression and fluorescence imaging.” Cell 159(3) (2014):635-46. PubMed PMID: 25307933. PubMed Central...Avoid Fluorescent Protein Oligomerization Learn about Small Molecule Fluorphores Resources on Addgene.org...

...Fragment Variables (scFvs). Nanobodies Figure 3: Comparison of the Hcab and nanobody. Nanobodies...molecule chaperone Skp. Front Cell Infect Microbiol 3: . https://doi.org/10.3389/fcimb.2013.00072 Additional...is referred to as an antigen. You can learn more about antibodies in our Antibodies 101 animation, What... expressing this protein. Read on to learn more about antibodies and how to use them in the lab! Parts...lots is a big concern. You can find more details about polyclonal antibodies on our Antibodies 101: Polyclonal...not necessarily what you are getting. Learn more about monoclonal antibodies here. Recombinant antibodies... as well as compare between samples. Learn more about flow cytometry. Cell and tissue labeling Antibodies...

...selection of pLKO.1 plasmid in mammalian cells. sin 3’LTR 3’ Self-inactivating long terminal repeat. f1 ori...antisense—TTTTTG 3’ Reverse oligo: 5’ AATTCAAAAA—21bp sense—CTCGAG—21bp antisense 3’ For example...Vector A.1 The RNAi Consortium A.2 Map of pLKO.1 A.3 Related plasmids B. Designing shRNA Oligos for pLKO... C.1 Recommended materials C.2 Annealing oligos C.3 Digesting pLKO.1 TRC-Cloning Vector C.4 Ligating and...Determining the optimal puromycin concentration F.3 Protocol for lentiviral infection and selection G....Sequence of pLKO.1 TRC-Cloning Vector I.2 Recipes I.3 Warranty information Back to Top A. pLKO.1-TRC Cloning...long terminal repeat. RRE Rev response element. A.3 Related Products The following plasmids available ...

... research constellations: Doench/Root (2), Zhang (3), Wu (4), Yusa (5), Wang/Lander/Sabatini (6), and ...PMID: 26780180. PubMed Central PMCID: PMC4744125. 3. Sanjana, Neville E., Ophir Shalem, and Feng Zhang... to design gRNAs for all the purposes discussed above. Please see videos and text on the website for more...Output: A text file containing full information about the suggested gRNAs to use, including all information... hard to read. It´s suggested that you open the above text files, copy the content of the file, and paste...Additional Resources on the Addgene Blog Learn about CRISPR Screens How to Design Your gRNA Tips for ...CRISPR User Resources on Addgene.org Learn More About CRISPR Find CRISPR Screening Libraries Browse All...

...practicing scientists. 3)   Consider starting up your own twitter feed or talking about and sharing some science...take on collaborative roles in academia, and that means it’s important to know how to talk about science...important for scientists to get out there and talk about their work. To tell others why that work is cool... than ever before for scientists to communicate about their work and their interest in science more generally...already make it a habit to talk – really talk – about the research you are doing in the lab with your ... the details of your science but also something about how science really works. 2)   Read science writing... told. Twitter can be a good way to follow news about particular subjects or find out what others are ...

...while AAV-PHP.S is typically used at a dose between 3 x 1011 and 1 x 1012 vg*. Most systemic capsids are...transduction in New World monkeys   Figure 3: Evolutionary tree depicting the phylogenetic relationship...414 (2019). https://doi.org/10.1038/s41596-018-0097-3 More resources on the Addgene blog Viral Vectors 101...Sensory Ganglion Neurons Using AAV-PHP.S. eNeuro,9(3), ENEURO.0373-21.2022. https://doi.org/10.1523/ENEURO...Are Limited to C57BL/6J Mice. Molecular Therapy, 26(3), 664–668. https://doi.org/10.1016/j.ymthe.2018.01.018... for their use. Then, we’ll provide information about commonly used and emerging capsids to help you decide...our Caltech Systemic Capsids page to learn more about that collection. Table 1: Systemic capsid plasmids...

...under the United States Internal Revenue Code 501(c)(3). That means we were formed to benefit the public,...Additional Resources on the Addgene Blog Learn about Our Collaboration with Fellow Nonprofit Seeding Labs Addgene...the American Cancer Society, or maybe you think about a local food pantry or community arts organization...community Addgene fosters a culture of respect, collaboration, and fun Addgene believes there is strength ...accelerate research with easier sharing and collaboration. Joanne and all the Addgenies: Adam, Amanda ...Connie Cepko Resources on Addgene.org Learn More About Our Mission Meet the Addgene Leadership Team Get...

...sets Taking the time to identify and research 2 – 3 potential professions will highlight which skills ...This great resource allows the undecided to learn about a variety of science professions based on their ...training focuses on using multidisciplinary, collaborative, and translational approaches for scientific...skills. Although the word “extracurricular” may be taboo in the lab, multiple research studies highlight ...social media (Twitter, Facebook, etc.) to learn about available jobs, fields, and trends “Never Leave...from your lab bench.  Want further information about shaping your career to your values, interests, and...Let us know what topic you'd like to learn more about next. Leave your suggestions in the comments section...

...forces or (2) the result of competing desires or (3) the presence of obstacles that need to be overcome... your science with others.    My favorite quote about science ever comes from an interview in which someone...storytelling business like to say, science is all about navigating conflict. In literary terms, conflict...find that once I sit down and talk to a scientist about their research, these conflicts come out quite naturally... a simple question, like “Have you ever thought about how X works?”, or even by introducing a person that...devices, we sometimes forget the most important thing about science: It’s cool. Like bowties! Using science ...

...and Transparency of Experimental Methods. Neuron 90(3):434-6. https://doi.org/10.1016/j.neuron.2016.04.030... also be collecting feedback from the community about how the antibodies work in various applications,...antibodies are plasmid-based and recombinant. Learn more about recombinant antibodies here. Finally, Addgene is...against PSD-95 from the Trimmer Lab. Information about the antibody, the target antigen, and performance...blog and Antibody Guide, which include information about immunofluorescence, conjugates, isotypes, and more...learn more or get started.  If you have suggestions about how to make the resource better or ideas for new...

...yellow fluorescent protein at the time. It is 1.5 to 3 times brighter than the most commonly used GFPs and...We are excited about our new partnership with Allele Biotechnology which allows researchers to deposit...blue-shifted compared to its parent protein CFP484. Collaborating with scientists from Florida State University...mWasabi plasmids here! One of the most notable things about these proteins is that they are monomeric fluorescent... fluorescent protein blog posts Find blog posts about choosing fluorescent proteins for your research ...the Addgene blog Resources on Addgene.org Learn about the Michael Davidson fluorescent protein collection...

...signaling pathway is unknown.      Figure 3: Chimeric OptoXR incorporating rhodopsin undergoes...Ultrafast optogenetic control. Nature Neuroscience, 13(3), 387–392. https://doi.org/10.1038/nn.2495 Marshel...which tools to use, and what do you need to know about them to be successful in your experiments? In this...

... is not prose; it is to be straight to the point. 3. Engage the reader Scientists forget that the reader...successful writer. When I originally talked to my PI about becoming a better writer, I was unsure if I should... a manuscript and critiquing it, were not too laborious, but helped build my understanding of how to generate...and the writing workshop. SWPI's writing workshop About a month later I received another email notifying... manuscript, scientists have a tendency to be elaborate and over explain the material. The point of writing...

...to safely get back to our lab work. Figure 3: When a bison wanders into the campsite, leave your...Addgene blog Learn about other Cas proteins Read all of our CRISPR blog posts Read about GeoCas9, another... able to eliminate the need for axenic (pure) laboratory cultures to study these microbes. From 16S rRNA...by flexibly deploying IgnaviCas9 without concern about its stability under harsh conditions. One example...

...last additional experiment requested by Reviewer #3. But why isn’t the plasmid here yet? A quick look ...materials as quickly as possible. (To learn more about why MTAs matter, check out another blog post: Why...provide specific examples if possible Tell them about the Golden Stopwatch! Any organization that deposits...California Institute of Technology Cold Spring Harbor Laboratory  Dana-Farber Cancer Institute  Fred Hutchinson...

...current with the latest and greatest! Addgene resources 3 Tips to Improve HDR Efficiency for CRISPR Editing ...most popular tweet from the conference is shown above. The blog post I mentioned, John Doench’s How to...forward. To do that, we need to learn much more about cellular DNA repair pathways. An emphasis on cellular...at the Keystone meeting had great things to say about CRISPOR, a tool to help you design, pick, and close...

... Find plasmids from this publication at Addgene. 3. Swarts, Daan C., et al. “Argonaute of the archaeon...impaired NgAgo activity, with three mismatches abolishing activity. One-guide faithful NgAgo guide loading... how it’s working in the comments section! Read About NgAgo User's First Impressions Here References ... Additional Resources on the Addgene Blog Read About Cas9 Homolog Cpf1 Check Out High Fidelty Cas9 Mutants...

...scoop from Addgenie A. Max Juchheim in this post. 3. Plasmids 101: E. coli Strains for Protein Production...eyes open for any new technologies that will bring about the next revolution in biological research. We’re...Plasmids 101: Control Plasmids Need help thinking about the types of controls you’ll need for your next ...Addgene Browse Our CRISPR Resources Learn More about Viral Vectors Browse the Repository  ...