We narrowed to 129 results for: primer

...strategies set experiments back days or even weeks. Primer design was done painstakingly by hand. Records ...

...sequencing (NGS). For gRNA libraries, you’ll design primers to create 200-300 bp sequencing products using ...

...87003-294 Primers/probe targeting ITR: ITR Forward Primer: 5’-CGGCCTCAGTGAGCGA ITR Reverse Primer: 5’-GGAACCCCTAGTGATGGAGTT...aliquots of master mixes, primers, and probes prior to use. Thaw the master mix, primers, and probe on ice before.... Ensure that primers, probe, 10X PCR buffer, and master mix are thawed. Vortex primers, probe and master... µL 250 nM Forward ITR Primer (10 µM) 1.8 µL 16.2 µL 900 nM Reverse ITR Primer (10 µM) 1.8 µL 16.2 µL ...vectors (AAV). This protocol specifically uses primers and probes targeting the ITR elements in the viral...

...Microcentrifuge tubes, VWR, 87003-294 Primers/probe targeting RRE: forward primer: tgtgccttggaatgctagt probe (FAM...µL 1X 20X RRE target primers/probe (FAM) 1 µL 9 µL 900 nM, 250 nM 20X RPP30 primers/probe (HEX/VIC) 1 µL...lentivirus vectors. This protocol specifically uses primers and probes targeting integrated copies of the Rev...target cells but can be modified for other targets. Primers and a probe against the cellular ribonuclease P... (2018) . Before Starting Thaw the master mix, primers/probe mixes and samples on ice before use. Wipe...(FAM): tttggaatcacacgacct reverse primer: aatttctctgtcccactccatc PrimePCR ddPCR Copy Number Assay: RPP30...ready to use. Preparing for ddPCR Thaw samples, primers/probe mixes, and master mix on ice. Before handling...

...Neuroscience, and the Future of Neuroengineering Primer on Optogenetics Resources at Addgene.org Addgene's...

...isolated plasmid DNA with appropriate sequencing primers, and hand deliver them to our Sanger provider. ...

... Addgene Blog Using virus in your research - a primer for beginners Adenoviral delivery of CRISPR/Cas9...

...template for PCR amplification with a degenerate primer set to amplify IgG variable light (VL) and variable...

... Your Research Using Virus in Your Research - A Primer for Beginners Resources at Addgene.org Find Virus...

...Lentiviral Transdution Using Virus in Your Research: A Primer for Beginners 5 Tips for Troubleshooting Viral ...