Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 130 results for: primer

Showing: 71 - 80 of 130 results

  1. Ligation Independent Cloning

    Type
    Protocol
    ...cloning vectors Protocol Step 1: Design Your Primers Primer design for LIC is often as simple as using ...For simplicity, only the 5' primer is shown here. Note: Use web-based primer design software to ensure ...must be built into the 5’ end of the respective primers. Below we use pNIC28-Bsa4 as an example of LIC ...codon or tag sequences (where appropriate). The primer length is dependent on the T4 Pol "chew back" reaction...add back the G and become stalled. Therefore, the primer must begin with the following T, so that there ... of 18 bp of your template sequence. 5' and 3' primers will have different leader sequences, but operate...melting temperature between 50-60°C for your PCR primers. Step 2: Linearize Vector In this example, the ...

  5. AAV ddPCR Titration

    Type
    Protocol
    ...87003-294 Primers/probe targeting ITR: ITR Forward Primer: 5’-CGGCCTCAGTGAGCGA ITR Reverse Primer: 5’-GGAACCCCTAGTGATGGAGTT...aliquots of master mixes, primers, and probes prior to use. Thaw the master mix, primers, and probe on ice before.... Ensure that primers, probe, 10X PCR buffer, and master mix are thawed. Vortex primers, probe and master... µL 250 nM Forward ITR Primer (10 µM) 1.8 µL 16.2 µL 900 nM Reverse ITR Primer (10 µM) 1.8 µL 16.2 µL ...vectors (AAV). This protocol specifically uses primers and probes targeting the ITR elements in the viral...

  6. Lentivirus ddPCR Titration

    Type
    Protocol
    ...Microcentrifuge tubes, VWR, 87003-294 Primers/probe targeting RRE: forward primer: tgtgccttggaatgctagt probe (FAM...µL 1X 20X RRE target primers/probe (FAM) 1 µL 9 µL 900 nM, 250 nM 20X RPP30 primers/probe (HEX/VIC) 1 µL...lentivirus vectors. This protocol specifically uses primers and probes targeting integrated copies of the Rev...target cells but can be modified for other targets. Primers and a probe against the cellular ribonuclease P... (2018) . Before Starting Thaw the master mix, primers/probe mixes and samples on ice before use. Wipe...(FAM): tttggaatcacacgacct reverse primer: aatttctctgtcccactccatc PrimePCR ddPCR Copy Number Assay: RPP30...ready to use. Preparing for ddPCR Thaw samples, primers/probe mixes, and master mix on ice. Before handling...

  9. AAV Q&A with Tim Miles

    Type
    Blog Post
    ... Addgene Blog Using virus in your research - a primer for beginners Adenoviral delivery of CRISPR/Cas9...
Showing: 71 - 80 of 130 results