Skip to main content
Addgene

We narrowed to 727 results for: cat.1

Showing: 211 - 240 of 727 results
  1. Easi-CRISPR: Generating Knock-In and Conditional Mouse Models

    Type
    Blog Post
    ...much more favorable than previous methods yielding 1-10% knock-in. Read on to learn how you can make CRISPR...one NHEJ-repaired indel, often occur. Figure 1: In conventional gene targeting (A), you must first... drug induction systems (ttA or rtTA) are between 1 to 2 kb in length. There are plenty of Addgene plasmid...CRISPR ribonucleoproteins.” Genome Biol. 18 (2017) (1):92. DOI: 10.1186/s13059-017-1220-4 PubMed PMID: 28511701... using long ssDNA donors.” Nat Protoc. 13 (2018) (1):195-215. DOI: 10.1038/nprot.2017.153 PubMed PMID:...engineering using CRISPR nucleases. Genome Biol. 19 (2018) (1):25. DOI: 10.1186/s13059-018-1400-x PubMed PMID: 29482575... allele To design a knock-in allele at a given location, you’ll need to design only a single guide and...
  2. Plasmids 101: Using Transposons in the Lab

    Type
    Blog Post
    ...2008) Transposons: The jumping genes. Nature Education 1(1):204. https://www.nature.com/scitable/topicpage... They transpose by a ‘copy-paste’ mechanism (Fig. 1). They first copy themselves as RNA transcripts and...their host’s genome.   There are two types of Class 1 TEs: those with long terminal repeats (LTRs) and those...reverse transcriptase activities.    Figure 1: Overview of retrotransposon transposition. Retrotransposons...CRISPR-Cas system. This system has four major components: 1) a CRISPR RNA (crRNA), 2) four proteins (TniQ, Cas8... It generally stays put, which makes it easy to locate in a genome. But there is a type of mobile DNA,... hyperactive and likes to jump around from one location in the genome to another. This jumping is what...
  3. CRISPR Protocol for Genomic Deletions in Mammalian Cell Lines [Video]

    Type
    Blog Post
    ...harness non-homologous end joining repair (NHEJ) [1]. Our initial work was with TALENs, in collaboration...from the University of Pennsylvania.     References: 1. Lee HJ, Kim E, Kim JS. Targeted chromosomal deletions...using zinc finger nucleases. Genome Res. 2010 Jan;20(1):81-89. PubMed. 2. Bauer DE, Kamran SC, Lessard S,... of Visualized Experiments (JOVE). The video publication by Stuart Orkin and Daniel Bauer's labs details... size and frequency [3]. There are several applications in which the production of deletions by paired...useful to study haploinsufficiency. Subsequent modifications at the remaining allele within the deletion ...
  4. RNA Interference in Plant Biology: New Tools for an Old Favorite

    Type
    Blog Post
    ...translation, or chromatin modifications of complementary gene sequences (Figure 1). As a result, gene silencing...benefited from the ease of use in dsRNA applications. Figure 1: Schematic of an RNAi-inducing transgene...dsRNA via an RNase III enzyme named Dicer (Figure 1). The plant kingdom has expanded its repertoire of...in the biogenesis of different small RNAs (Figure 1). These siRNAs can exert their gene silencing effect...complementary to your gene target as inverted repeats (Figure 1). With this technique, multiple genes can be simultaneously...selection of plants undergoing RNAi, and LIIbeta F 1-2 RNAi, which allows assembly of intron-spliced hpRNAs...silencing can be easily induced by exogenous application of long or short dsRNA. However, it is important...
  5. The Materials Science of Optogenetics Experiments

    Type
    Blog Post
    ... different steps and materials required for each [1, 2]. This protocol [3] provides, in exquisite detail...follow him on Twitter @derekpsimonphd.    References 1. Gutierrez DV, et al. Optogenetic control of motor...manipulation of neural circuits. Nature protocols. 2012;7(1):12-23. doi: 10.1038/nprot.2011.413. PubMed PMID: ...freely moving mice. Neuroscience research. 2011;70(1):124-7. doi: 10.1016/j.neures.2011.01.007. PubMed ...There are several important considerations with fabrication of the fiber optics needed for optogenetics. ... for the implant depends on the dorsal/ventral location of your region of stimulation (the z-axis bregma...emitted from the end of the fiber optic implant scatters a great deal once it enters tissue, placement ...
  6. Rosella: A Fluorescent pH-Biosensor for Studying Autophagy

    Type
    Blog Post
    ...’s fused to the C-terminus of DsRed.T3. See Table 1 for a summary of Rosella’s excitation and emission...fluorescence Rosella emits based on its localization. Table 1: Summary of Rosella’s excitation and emission spectra... variants are available from Addgene. References 1. Rosado, C., Mijaljica, D., Hatzinisiriou, I., Prescott...single fluorescent biosensor. Scientific Reports,5(1). doi:10.1038/srep12397. PubMed PMID: 26215030. PubMed...radioactivity in the culture supernatant (this is indicative of protein degradation). To control for protein...studying autophagy. This method relies on the identification of autophagic structures based on morphology...
  7. Allen Institute for Brain Science AAV Enhancer Collection

    Type
    Collection
    ...Tools Atlas (Link opens in a new window) . Figure 1: Selection, prep, and testing of AAV enhancers in ...Capsids AAV Packaged on Request AAV Guide Plasmids Publications Enhancer AAV plasmids are plasmids which use...= Substantial non-specific labeling observed Publications Ben-Simon Y, Hooper M, Narayan S, Daigle T, ...
  8. Expanded Access to Rabies Plasmids

    Type
    Blog Post
    ...requestors. We also offer export license applications for VSV and SARS-COV-1 plasmids. Export control license...  We have offered VSV and SARS-COV-1 plasmids under this application process since May 2020. We find this...excited to announce we now offer an export license application for rabies materials! Some of the materials in...export-controlled materials in the USA, where Addgene is located.  The export license, if granted, allows us to ... applied to cover processing costs. Once the application is approved, Addgene then ships the material ...whenever possible, as we cannot expedite the application process.  More information about export control...
  9. Antibodies 101: Affinity Tags

    Type
    Blog Post
    ...118). Humana Press. https://doi.org/10.1385/1-59259-301-1:99 Resources on Addgene.org Addgene antibodies...antibody for that!   Fig. 1 - Diagram of His-tagged protein purification work flow by nickel column....cleaved after purification, so as not to perturb protein function for downstream applications. Tag cleavage...thoughtful planning, affinity tags can make protein purification a cinch. Types of affinity tags, the proteins... Affinity tags are used primarily as protein purification tools (and can have secondary functions as detection...single protein is expressed, with the intent of purification, it will be expressed along with all other cellular...available antibodies, resins, beads, and other purification aids readily available. Choosing the best tag...
  10. Nanoblades: Tiny CRISPR Ninjas for Genome Editing Difficult Cells

    Type
    Blog Post
    ...following four components into 293T cells. Figure 1: The key components of Nanoblades. Image from Mangeot...protein. A single Nanoblade particle can be loaded with 1-4 different gRNAs. Viral envelope proteins To alter... between ~50-70% for these four cell types (Table 1). Additionally, hiPSCs and mouse BM cells still behaved...hepatocytes  Myd88  ~50% Human HSCs  Myd88  ~50% Table 1: Nanoblades editing efficiencies of primary cells....including RNPs for indel formation via NHEJ, precise modification with Homology Directed Repair (HDR), CRISPR ...potential to be used for other types of CRISPR applications. Let’s take a look at the key components of ... which means they are non-infectious and non-replicative. Nanoblades are produced by transfecting the ...
  11. Mouse Modeling, Part 1: Genetically Engineered Mice

    Type
    Blog Post
    ...stimuli. Cre recombinase catalyzes the recombination of DNA sequences located between two loxP sites. ...in research can fall under one of two broad classifications: inbred or outbred. Inbred strains share a ...Knockout mice Knockout mice have undergone genetic modification that alters or eliminates the expression of ...can be used to invert a segment of DNA or to translocate a piece of DNA from one region of the genome ...
  12. Fluorescent Proteins 101: Introduction to FRET

    Type
    Blog Post
    ...spectral overlap, the fluorophores must be located within 1-10nm of each other and be oriented appropriately... to make the decision easier. 1. Müller, Sara M., et al. "Quantification of Förster resonance energy transfer...acceptor fluorophore. The typical steps in FRET are: 1. Donor fluorophore excitation by absorption of a photon...diseases and even assist in drug discovery. References 1. Baird, Geoffrey S., et al. "Circular permutation ...have enhanced the ability of labs to answer sophisticated questions about cellular processes. Currently...PMC18018. 2. Miyawaki, Atsushi, et al. "Fluorescent indicators for Ca2+ based on green fluorescent proteins ...
  13. Plasmids 101: Restriction Cloning

    Type
    Blog Post
    ...let’s go over the details step-by-step. 1. Digestion Set up restriction digests for your insert (or donor...recipient plasmid : insert ratio” of approximately 1:3. Since the number of base pairs for each varies,...cells. For most standard cloning, you can transform 1-2μl of your ligation reaction into competent cells...at minimum, two transformations after a ligation: 1. Control Transformation containing the ligation mixture...result in few colonies on both plates (unsuccessful 1), in a vector alone plate with many more colonies ...them. An easy way to do this is gel purification. In gel purification, you use a voltage difference across...backbone. Sample results indicative of successful and unsuccessful ligations are indicated below. A successful...
  14. Sequencing Primers

    Type
    Guide
    ...immediate early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward... Rabbit beta-globin polyA region, reverse primer CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol ...LexA CGTCAGCAGAGCTTCACCATTG (Caldwell lab) 3' end of LexA DNA binding domain, forward primer LKO.1 5' GACTATCATATGCTTACCGT... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC...tdTomato-Fwd CTGTTCCTGTACGGCATGG 3' end of tdTomato, forward primer tdTomato-Rev TCTTTGATGACGGCCATGT 5' end ...primer WPRE-R CATAGCGTAAAAGGAGCAACA 5' end of WPRE, reverse primer XBG-R GACTCCATTCGGGTGTTC Xenopus beta-globin...sequencing primers that Addgene uses for sequence verification of deposited plasmids. Plasmid...
  15. CRISPR Guide

    Type
    Guide
    ...editing efficiency and fidelity. Nature Communications , 13 (1), 1425. PMID: 35301321 Edraki, A., Mir,... DNA interrogation by SpRY-Cas9. Nature Communications , 15 (1), 3663. PMID: 38688943 Hsu, P. D., Scott...CRISPR-Cas9 to increase its specificity. Nature Communications , 9 (1). PMID: 30082838 Maddalo, D., Manchado, ...with an engineered chimeric Cas9. Nature Communications , 14 (1), 6175. PMID: 37794046 Small precision ...integration by homology-dependent repair. Nature Communications . 9 (1), 1133. PMID: 29556040 Chen, P. J., Hussmann...transcriptional reprogramming in bacteria. Nature Communications . 9 (1), 2489. PMID: 29950558 Fujita, T., & Fujii.... Biochemical and Biophysical Research Communications . 439 (1), 132–136. PMID: 23942116 Gilbert, L. A...
  16. Quick Guide to Near-Infrared Fluorescent Proteins

    Type
    Blog Post
    ...2021).   Table 1: Properties of modern NIR FPs     NIR FP Ex, nm Em, nm ECa, M-1cm-1 QYb, %   Molecular...expression level. State-of-the-art FPs (listed in Table 1) were optimized for efficient binding of endogenous...previously reported widely used dimeric iRFPs (Table 1). In general, the monomeric state of a probe leads...iRFPs in cellular and molecular brightness (Table 1).  NIR reporters and biosensors NIR reporters can ...calcium indicator (Shemetov et al., 2021). In addition to FRET, intensiometric calcium indicators NIR-GECOs...characteristics, performance, and applications of near-infrared calcium indicators in this recent review (Shcherbakova...information on NIR FPs, their properties and applications. At the end, there is a Table that summarizes...
  17. SARS-CoV-2/COVID-19 Detection Methods Based on CRISPR/Cas

    Type
    Blog Post
    ...In the case of HIV-1 and SARS-CoV-2 detection, AIOD-CRISPR without preamplification was able to detect... to other technologies like CRISPR. Figure 1: An overview of the general schematic of CRISPR/Cas... can be detected – in the zeptomolar range Time: ~1 hour Equipment required: 37°C water bath and 42°C ... Not mentioned in the paper, likely approximately 1-2 hours Equipment needed: Mini PCR machines by DIY-Bio...femtomolar  Time: Not mentioned, likely ~1-2 hours Equipment needed: PCR machines/Heat blocks, Lateral...recombinase polymerase amplification (RPA) using a commercially available amplification kit. In this case,... RNA is extracted and subject to isothermal amplification by primers that target the E and the N2 gene...
  18. Addgene-Seeding Labs Plasmid Grant: Accelerating Science Globally - 5 Scientists, 4 Countries & 3 Continents!

    Type
    Blog Post
    ... compounds with various antimicrobial activities (1). She has developed a fast endophyte screening system...us coordinate and promote the awards. References 1. Martinez-Klimova, Elena et al. “Endophytes as sources...antibiotic” Biochemical Pharmacology 2017 Jun 15;134:1-17. PubMed PMID: 27984002. 2. Bilan, Dmitry S. et ...scientists work on projects spanning from the identification of plant compounds and insecticidal proteins...bacteria. Learn more about the different CRISPR applications in plants.     Transgenic yeast as source of... yeast capable of desaturating fatty acids. Identification of Insecticidal Proteins Linh Bao Ton (M. Sc...Arturo Rivera Solís, Universidad Autónoma de Yucatán, Mexico Dr. Rodrigo Arturo Rivera Solís, Associate...
  19. A Needle in a Base-Stack: Cas9 Structural Biology

    Type
    Blog Post
    ... basic parts of the Cas9 enzyme.   Figure 1: A cartoon depiction of Cas9’s two major lobes, REC...the CRISPR system (Nishimasu et al., 2014). Table 1. Summary of Cas9 domains, the lobe each domain belongs...state (PDB ID 4CMP) with domains colored as in Figure 1. HNH, red; RuvC, orange; CTD, yellow; REC lobe, light... on itself at the bottom of the image. Stem loops 1 and 2 extend horizontally across both lobes. The guide...outside of the protein, spanning both lobes. Stem loop 1, nestled between the REC and CTD domains, is required...Within an interior cavity, Cas9 grips nucleotides 1-10 of the guide RNA, prearranged for base pairing ...343–347. https://doi.org/10.1038/s41586-022-04470-1 Cofsky, J. C., Soczek, K. M., Knott, G. J., Nogales...
  20. Antibodies 101: Conventional vs Spectral Flow Cytometry

    Type
    Blog Post
    ...This complexity index ranges from 0-1, with a value of “0” indicating those markers are completely distinct...distinct from one another, and a value of “1indicating those markers are identical and completely indistinguishable...detector for that fluorophore. For example, in figure 1, the FITC signal is spilling over into the primary...spectra to use for compensation.     Figure 1: The emission spectra and filters for FITC and PE ... tumors, and moreso than other methods, the identification and isolation of rare cell types. In recent...
  21. RUBY-Red Siliques

    Type
    Blog Post
    ...in all other plants, anthocyanins.   Figure 1: An adult plant expressing RUBY. Photos by Andrew ... be collected from heterozygous individuals. Only 1/4 of the descendants of the heterozygous plants, therefore... (2020). https://doi.org/10.1038/s41438-020-00390-1 Additional resources on the Addgene blog  CRISPR 101...markers for plant transformation fall into two main categories: antibiotic/herbicide resistance and fluorescent...culture), which is great for a wide variety of applications. But some techniques require you to select against...these mutant plants. Using RUBY to simplify the identification of these mutants will speed up my work and ...student studying plant development and cell-cell communication in the Nimchuk Lab in the Biology Department...
  22. How to Deposit Your Plasmids with Addgene

    Type
    Blog Post
    ... emailed submission) in the Deposit menu: Figure 1: Begin the deposit process by clicking "Submit Online...cases Please contact us at [email protected] or +1 (617)-ADDGENE (233-4363) if your deposit falls into...Addgene?" or contact us at [email protected] or +1 (617)-ADDGENE (233-4363) with additional questions...strain. Please contact us at [email protected] or +1 (617)-ADDGENE (233-4363) if you’d like to distribute...page so that any data you enter is not lost.   Step 1: Sequences, Maps, and Files Please provide any full...a 1.5 mL microfuge tube at a concentration of 0.1–1 µg/µL (or bacterial streaks, if you prefer). If you...in PubMed and choose the appropriate publication. This publication will be listed at the top of the final...
  23. Cpf1 Update: Comparison to Cas9 and NgAgo

    Type
    Blog Post
    ...Figure 1: Effects of (A) double and (B) single base pair gRNA-target mismatches on modification by AsCpf1...that Cpf1 can tolerate mismatches at gRNA positions 1, 8, 9, and 19-23. Accordingly, the 3’ end of the gRNA...Most gRNAs directed low-frequency Cpf1 cleavage at 1-12 off-target sites; in contrast, SpCas9 may cleave...fits into the genome editing landscape. References 1. Kim D, Kim J, Hur JK, Been KW, Yoon SH, Kim JS. Genome-wide...eclipse any of the CRISPR nucleases in AAV-based applications. Get More Cpf1 Background Here THE ORIGINAL ...red) or LbCpf1 (blue). Mismatch positions are indicated below each graph. Figure adapted from Kleinstiver... off-target editing rates, determined using sophisticated genome-wide analysis. At many of its computationally...
  24. Evolution of Brainbow: Using Cre-lox for Multicolor Labeling of Neurons

    Type
    Blog Post
    ...labeling of delicate axonal and dendritic processes not previously visible with Brainbow-1 and -2. The...the Brainbow mouse neural labeling system. Brainbow-1 and -2 have been further refined to create Brainbow...subsequent recombinations cannot occur. While the Brainbow-1 system employs Cre-mediated deletion, the design of...antibodies specific to each fluorophore. Third, Brainbow-1 and Brainbow-2 each contained a “default” state; for...Rheenen J, Simons BD, Clevers H. Cell. 2010 Oct 1;143(1):134-44. PubMed. Drosophila Brainbow: a recombinase-based...Between Brainbow Systems   Brainbow variants and applications beyond the mouse brain In addition to improving...temporal control without the need for germline modification, and enables Brainbow to be used in a variety...
  25. Your Lentiviral Plasmid FAQs Answered

    Type
    Blog Post
    ... vectors are: 1) the potential generation of replication competent virus [usually HIV-1]; and 2) the potential...systems have been developed over the years based on HIV-1; however, the 1st-generation vectors are never used...which has been shown to repress expression of HIV-1 LTRs (more information is available here). 2nd vs...lentiviral plasmids created for a variety of applications including cDNA expression, shRNA-mediated knockdown... looking for some additional information or clarification on these vectors. Read on to find the answers... thus decreasing the probability of creating replication-competent lentivirus (RCL) in your target cells...type or tissues; this is useful in gene therapy applications where a distinct subset of the cellular population...
  26. 3 Tips to Improve HDR Efficiency for CRISPR Editing in Human Cells

    Type
    Blog Post
    ...events by HDR can be generated more efficiently by (1) improving editing accuracy by preventing re-editing...specifically incorporate homo- or heterozygous mutations. 1. Increasing HDR accuracy with CRISPR/Cas-blocking ...targeted alleles when gene editing.   Figure 1: Techniques to improve editing efficiency.   But...provided by blocking mutations. Essentially, you:  Step 1 - Introduce the blocking mutation together with the...developing novel iPSC-based model systems.     References 1. Cong, Le, et al. "Multiplex genome engineering using...many cell types and often results in biallelic modifications. Most commonly, DSBs are repaired by the nonhomologous...
  27. Optogenetics + CRISPR, Using Light to Control Genome Editing

    Type
    Blog Post
    ...), paCas9-1 induced indel mutations via NHEJ (frequency of 20.5%) and induced modifications by HDR (frequency...2 (CRY2) and calcium and integrin-binding protein 1 (CIB1) proteins. The goal of both groups was to create... the Sata lab is composed of two fusion proteins: 1) the genomic anchor - an inactive, dead Cas9 protein...combination. The optimized LACE system consisted of: 1) CIBN-dCas9-CIBN, where CIBN is the N-terminal fragment.... crassa) (Kawano et al., 2015). Nicknamed paCas9-1 and consisting of the fusion proteins N713-pMag and...fold-induction of Cas9 activity (16.4-fold). This paCas9-1 light-inducible system was able to recognize the same...background activity of the system by modifying paCas9-1 using nMagC714 instead of nMagHigh1-C714, generating...
  28. Choosing a Good Mentor for Scientists

    Type
    Blog Post
    ...setting out of the lab (coffee, lunch or beer) and in 1:1 conversations. This creates a level of familiarity... other posts in our Science Mentors series: Part 1: "What Makes a Good Mentor?" and 6 More FAQs About...problems, develop general technical proficiency, communicate your work, maintain ethical standards and interact...websites listing alumi and it is easy to use publication records, university websites, ResearchGate and...
  29. Plasmids 101: Origin of Replication

    Type
    Blog Post
    ...produce as many as 700 copies per cell. Figure 1: A plasmid map showing the standard features of a ...the origin of replication/replicon. The replicon is comprised of the origin of replication (ori) and all...   Types of origins of replication There are lots of origins of replication out there so, for simplicity...gene for replication (reference). **F1 is a phage-derived ori that allows for the replication and packaging...control elements. The ori is the place where DNA replication begins, enabling a plasmid to reproduce itself...are generally different from the those used to replicate the host's chromosomal DNA, but they still rely...readily at lower temperatures and allows the replication machinery room to come in and get busy making...
  30. Chromoproteins: Colorful Proteins For Molecular Biology Experiments

    Type
    Blog Post
    ...attract fish for them to prey upon (Figure 1). Figure 1: The sea anemone's red color can be used ...synthetic biology. Journal of Biological Engineering, 12(1). https://doi.org/10.1186/s13036-018-0100-0 Murakoshi...expression in living cells. Scientific Reports, 9(1). https://doi.org/10.1038/s41598-019-48604-4 Salih... sequencing are more definitive, but visual identification is a good place to start before taking on more...resources are limited or for bioart and teaching applications. Find a chromoprotein for your experiment! ...events: The plasmid carrying the desired genetic modification integrates into the genome (Figure 3). Here,...of Allelic-Exchange Vectors for the Scarless Modification of Proteobacterial Genomes. Applied and Environmental...
Showing: 211 - 240 of 727 results