Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 188 results for: Coli

Showing: 141 - 160 of 188 results

  2. COVID-19 Resources

    Type
    Collection
    ...plasmids. The collection contains: Plasmids for E. coli and Yeast expression Spike protein constructs for...

  4. Hot Plasmids: Fall 2024

    Type
    Blog Post
    ...construct can be easily expressed and purified from E. coli, retains important functional properties, and is...

  5. Site Directed Mutagenesis by PCR

    Type
    Blog Post
    ...PCR reaction, no ligation is required since the E. coli you transform your PCR products into will efficiently...

  7. Validated gRNA Sequences

    Type
    Collection
    ...article 60224 cut S. pyogenes 25263330 Zhang LacZ E. coli TGCGAATACGCCCACGCGAT 60225 cut S. pyogenes 25263330...ACTCCAGTCTTTCTAGAAGA 64216 cut S. pyogenes 25803306 Kuhn rpsL E. coli AAAAAACCGAACTCCGCGCTGCGTAAAGTA 44505 cut S. pyogenes...AAGTTCGTATGGAAGGTTCCGTTAA 74075 interfere S. pyogenes 26829286 Lu LacZ E.coli CCCGAATCTCTATCGTGCGG 74179 cut S. pyogenes 26627737...

  9. Molecular Biology Reference

    Type
    Guide
    ...to use in an experiment. E. coli strains for propagating plasmids E. coli are gram-negative, rod shaped...Addgene blog posts relating to common E. coli lab strains and E. coli strains specialized for protein expression... with Plasmids Introduction Types of Plasmids E. coli strains for propagating plasmids Antibiotics commonly...For instance, most plasmids are replicated in E. coli and are relatively small (∼3000 - 6000 basepairs.... When a plasmid exists extrachromosomally in E. coli , it is replicated independently and segregated ...many different naturally occurring strains of E. coli , some of which are deadly to humans. The majority...majority of all common, commercial lab strains of E. coli used today are descended from two individual isolates...

  10. Modular Cloning Guide

    Type
    Guide
    ...constructs constrained only by the ability of E. coli to maintain the final plasmid after transformation...purification tags and fluorescence proteins for use in E. coli for a variety of applications. EcoFlex MoClo Extension...backbones, and 6 destination vectors for use in E. coli for a variety of applications. CIDAR MoClo Parts...combinatorial design and expression tuning in E. coli . CIDAR MoClo Extension, Volume I Bacterial Expression...ubiquitination cascades of different organisms in E. coli . MetClo DNA Assembly Kit Bacterial Expression Christopher...and FBF (PUF) homology domain, for mammalian or E. coli expression. T2A Split/Link TurboID Kit Mammalian...

  11. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...post: Synthetic Photobiology: Optogenetics for E. coli. Schmidl, et al. ACS Synth Biol. 2014 Nov 21...aggregation propensity in four expression systems: E. coli, wheat germ, HeLa, and Leishmania (Gagoski, et al... replication increases plasmid copy number in E. coli. The authors used pXPG to study the human GM-CSF... F30-2xdBroccoli are available, as well as 5S RNA F30-2xdBroccoli fusion and pET28c-F30-Broccoli controls...mammalian cells with Broccoli Vegetable tags, including Spinach, Spinach2, and Broccoli, can benefit your...scaffold allows insertion of two dimeric Broccoli tags (2xdBroccoli) to further enhance fluorescence of the...controls. Don’t just eat more broccoli, use Broccoli tags in your experiments too! Filonov, et al. Chem...

  13. Luciferase Plasmid Collection

    Type
    Collection
    ...luciferase gene allow for increased copy number in E. coli and expression of luciferase in the cytoplasm of...

  16. CRISPR Guide

    Type
    Collection
    ...created by directed evolution of the Escherichia coli TadA, a tRNA adenosine deaminase. Like cytosine ...the DNA and replaces it with another base. In E. coli , this strategy yields C to A base edits, whereas...harnessed for antiviral mechanisms in bacteria ( E. coli ). Like the other Cas enzymes, the Cascade-Cas3 .... (2018). Genome-wide CRISPR-dCas9 screens in E. coli identify essential genes and phage host factors....

  19. Sequencing Primers

    Type
    Guide
    ...ATGCCATAGCATTTTTATCC (Invitrogen) For vectors with E. coli araBAD promoter, forward primer pBAD Reverse GATTTAATCTGTATCAGG...GATTTAATCTGTATCAGG (Invitrogen) For vectors with E. coli araBAD promoter, reverse primer pBluescriptKS TCGAGGTCGACGGTATC...
Showing: 141 - 160 of 188 results