Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 26 results for: Coli

Showing: 1 - 20 of 26 results

  1. Bacterial Expression Systems

    Type
    Collection
    ...modular cloning (MoClo) for use in E. coli . Addgene Blog E. Coli Strains for Protein Expression Protein...aTc) Escherichia coli Stanley Qi 11518 pDest-527 T7-lacO Lactose/IPTG Escherichia coli Dominic Esposito...Arabinose Escherichia coli Christian Raetz 26098 pCW-LIC 3xPtac Lactose/IPTG Escherichia coli Cheryl Arrowsmith...Escherichia coli Cheryl Arrowsmith 43795 pDusk pR_FixK2 Blue light (470 nm) Escherichia coli Andreas Moeglich.../IPTG Escherichia coli Cheryl Arrowsmith 46886 pMSP3535 PnisA Nisin Escherichia coli , gram-positive bacteria...Escherichia coli , Streptomyces sp. Xuming Mao 46888 pMSP3545 PnisA Nisin Escherichia coli , gram-positive...Propionate Escherichia coli Jay Keasling 17810 pPro33 pPrpB Propionate Escherichia coli Jay Keasling 113634...

  2. Open Enzyme Collection

    Type
    Collection
    ...pOpen-Endonuclease IV E. coli E. coli Endonuclease IV 165561 pOpen-Endonuclease VIII E. coli E. coli Endonuclease ...Endonuclease VIII 165571 pOpen-Exonuclease III E. coli E. coli Exonuclease III 165559 pOpen-T5gene12/13 T5 Exonuclease... pOpen-T4gene30 T4-DNA Ligase 165564 pOpen-ECOligA E. coli DNA Ligase 165569 pOpen-Tthlig Tth DNA Ligase...Open Enzymes parts for expression in Escherichia coli bacteria. Researchers can use the collection as ... vector of their choice and transforming into E. coli bacteria. This can help reduce lab costs and overcome...vector of their choice and then transform into E. coli for expression and purification ( pET28a-LIC or ... . Open Enzymes are also compatible with the E. coli Protein Expression Toolkit (Link opens in a new ...

  3. Microbiology Resources

    Type
    Collection
    ...set : E. coli gene expression - Endy Lab CIDAR MoClo Parts Kit : Molecular cloning for E. coli - Densmore...plasmids is a bacterial stab (of a laboratory E. coli strain). Addgene continues to monitor its library...export laws and biosafety regulations. Looking for E. coli or yeast plasmids? Addgene has a wide variety of... Fluorescent Proteins FRET-based biosensors : E. coli expression - Pertz Lab Bacterial Fluorescence Labeling...pCri System : Heterologous protein expression in E. coli, B. subtilis and P. pastoris - Gomis-Rüth Lab pOSIP... purification and cell-free circuit design in E. coli - Freemont Lab MoClo-YTK : Assembly of single and...CRISPathBrick Multiplex Plasmid : CRISPR expression in E. coli - Koffas Lab Additional Addgene Resources Synthetic...

  4. Genetic Code Expansion

    Type
    Collection
    ...tyrosyl-tRNA synthetase E. coli pBof Mammalian TAG Huiwang Ai 68292 SepOTSλ SepRS9 E. coli Sep Bacterial TAG Jesse... E. coli photocaged cysteine Mammalian TAG Huiwang Ai 73544 pEvol-pAcFRS.2.t1 pAcFRS.2.t1 E. coli p-acetyl-l-phenylalanine...synthetase E. coli Mammalian TAG Simon Elsaesser 140019 pAS_4xEcoLeuT(CUA)_AnapRS AnapRS E. coli 3-(6-acetylnaphthalen... first with a control reporter gene – GFP for E. coli or mCherry-GFP for mammalian cells. You should also...Bacterial TAG Peter Schultz 48696 pANAP AnapRS E. coli 3-(6-acetylnaphthalen-2-ylamino)-2-amino-propanoic...pAcBac2.tR4-OMeYRS/GFP* tyrosyl-tRNA synthetase E. coli various unnatural amino acids Mammalian TAG Peter...Mammalian TAG Peter Schultz 51401 pAM1 NLL-MetRS E. coli azi-donorleucine (Anl) Bacterial ATG David Tirrell...

  5. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...,170 Bikard Lab E. coli Genome-wide Inhibition Library v1 115927 Inhibition E. coli Bikard N/A 19 92,919...Bikard Lab EcoWG1: E. coli Genome-wide Inhibition Library v2 131625 Inhibition E. coli Bikard N/A ∼5 21,417...Zhang E. coli Genome-wide Inhibition Library 113134 — 113138 113146, 113147 Inhibition E. coli Chong Zhang...Other Species Human Mouse Fly Yeast T. gondii E. coli P. aeruginosa S. pneumoniae M. tuberculosis M. smegmatis...Protospacer flanking site (PFS) Library 79153 Knockout E. coli Zhang N/A N/A N/A - The protospacers contained in...

  6. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ...phosphorylated amino acid to the genetic code of E. coli (Park et al., 2011). Follow up work from the Rinehart...the parent protein. Using the recoded strain of E. coli , C321.ΔA (Bacterial strain #68306) , with the optimized...phosphosite library configuration for overexpression in E. coli . The phosphosite DNA library can also be introduced...flexible codon in genomically recoded Escherichia coli permits programmable protein phosphorylation . Nature...Enhanced phosphoserine insertion during Escherichia coli protein synthesis via partial UAG codon reassignment...2011). Expanding the Genetic Code of Escherichia coli with Phosphoserine . Science , 333 (6046), 1151–...production with rEcoli XpS and a new pSerOTS The Rinehart lab developed a new strain of recoded E.coli , rEcoli...

  7. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...BsaI E. coli, S. pneumoniae Kanamycin none, need Cas9 plasmid Marraffini 42876 pCas9 BsaI E. coli, S. pneumoniae...

  8. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...Repeat) sequences were initially discovered in the E. coli genome in 1987, but their function as a safeguard...Mammalian systems (Human, mouse, and rat) Bacteria ( E. coli , Streptococcus , Streptomyces , and others) Drosophila...alkaline phosphatase isozyme conversion in Escherichia coli, and identification of the gene product. J Bacteriol...

  9. CRISPR Plasmids - Base Edit

    Type
    Collection
    ...created by directed evolution of the Escherichia coli TadA, a tRNA adenine deaminase. Like cytosine base...

  11. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...production of His6-MBP-tagged fusion proteins in E. coli SUMO Protein purification pCIOX - Bacterial expression...cleavage pExp-NusA - Expression of protein in E. coli as TEV cleavable N-terminal His and NusA fusions...

  12. Promega Plasmid Collection

    Type
    Collection
    ... various protein expression systems including E. coli , mammalian cells, and cell-free systems. HiBiT ...

  13. Viral Production

    Type
    Collection
    ...propagated in the endA -mutated NEB Stable strain of E. coli . In addition, plasmids are typically prepared using...

  15. COVID-19 Resources

    Type
    Collection
    ...plasmids. The collection contains: Plasmids for E. coli and Yeast expression Spike protein constructs for...

  16. Validated gRNA Sequences

    Type
    Collection
    ...article 60224 cut S. pyogenes 25263330 Zhang LacZ E. coli TGCGAATACGCCCACGCGAT 60225 cut S. pyogenes 25263330...ACTCCAGTCTTTCTAGAAGA 64216 cut S. pyogenes 25803306 Kuhn rpsL E. coli AAAAAACCGAACTCCGCGCTGCGTAAAGTA 44505 cut S. pyogenes...AAGTTCGTATGGAAGGTTCCGTTAA 74075 interfere S. pyogenes 26829286 Lu LacZ E.coli CCCGAATCTCTATCGTGCGG 74179 cut S. pyogenes 26627737...

  18. Luciferase Plasmid Collection

    Type
    Collection
    ...luciferase gene allow for increased copy number in E. coli and expression of luciferase in the cytoplasm of...

  19. CRISPR Guide

    Type
    Collection
    ...created by directed evolution of the Escherichia coli TadA, a tRNA adenosine deaminase. Like cytosine ...the DNA and replaces it with another base. In E. coli , this strategy yields C to A base edits, whereas...harnessed for antiviral mechanisms in bacteria ( E. coli ). Like the other Cas enzymes, the Cascade-Cas3 .... (2018). Genome-wide CRISPR-dCas9 screens in E. coli identify essential genes and phage host factors....
Showing: 1 - 20 of 26 results