We narrowed to 130 results for: primer
-
TypeBlog Post...Neuroscience, and the Future of Neuroengineering Primer on Optogenetics Resources at Addgene.org Addgene's...
-
With Our New Viral Service, We're Taking CRISPR Further!
TypeBlog Post...Lentiviral Transdution Using Virus in Your Research: A Primer for Beginners 5 Tips for Troubleshooting Viral ... -
The CRISPR Software Matchmaker: A New Tool for Choosing the Best CRISPR Software for Your Needs
TypeBlog Post...features to help with the post-design process such as primer and plasmid design. Examples: “multiplex design...or multiplex features. However, tools aiding in primer design are more and more common. User interaction... -
AAV Titration by qPCR Using SYBR Green Technology
TypeProtocol...Master Mix 2X Primer pair targeting AAV2 ITR ( Aurnhammer et al., 2012 ) fwd ITR primer, 5'-GGAACCCCTAGTGATGGAGTT...10 μL 1,000 μL 100 μM Forward Primer 0.15 μL 15 μL 100 μM Reverse Primer 0.15 μL 15 μL Nuclease Free Water...GGAACCCCTAGTGATGGAGTT rev ITR primer, 5'-CGGCCTCAGTGAGCGA ITR-containing plasmid for standard curve RNase-free... SYBR master mix, then the forward and reverse primers. Vortex briefly, immediately before use. Use a ... of ~70–75 °C usually indicates the presence of primer dimers which can increase background signal and... -
It’s Bioelectric! An Exciting Interdisciplinary Field of Research
TypeBlog Post...on the Addgene blog: Addgene Optogenetics guide Primer on Optogenetics blog series Addgene Biosensors ... -
Quick Guide to Working with Drosophila Part 3: Genome Engineering in Flies
TypeBlog Post...amenability to genetic manipulation. This is just a primer so that you are aware of at least some of the possibilities... -
The time and cost required to make a plasmid
TypeBlog Post...chatting quickly with the postdoc who’s really good at primer design – but first, you have to know what resources... -
New Tool for Lineage Tracing: The ClonTracer Library
TypeBlog Post...amplified using the same sets of forward and reverse primers). The abundance of a particular barcode sequence... -
CRISPR References and Information
TypeCollection...design (10 different prediction scores), clone (primer design), and evaluate gRNAs, as well as predict... -
Sequencing Primers
TypeGuide... Reference Sequencing Primers Sequencing Primers Looking for Primers? The primer sequences listed on the... and see what primers are listed under "5' sequencing primer" and "3' sequencing primer". Still not sure...forward primer Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase, forward primer RVprimer3 CTAGCAAAATAGGCTGTCCC...not distribute primers. For sequencing plasmids in our repository, we've chosen primers based on the plasmid...sure what primer you need? Email us at [email protected] Addgene has used a number of primers for sanger... Reference Page . All listed primers are 5′ to 3′. Commonly Used Primers CMV Forward CGCAAATGGGCGGTAGGCGTG...forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward primer LucNrev ...