Skip to main content

We narrowed to 1,033 results for: CAT;

Showing: 161 - 180 of 1033 results
  1. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...extensively validated for neuroscience research applications. A substantial number of these have been cloned...expression, and an ER signal/leader sequence (L) for translocation of the heavy chain across the ER membrane. PCR-mediated...expression, and an ER signal/leader sequence (L) for translocation of the light chain across the ER membrane. Downstream...antibodies are produced in-house and undergo application-specific validation and quality control by Addgene...opens in a new window) UC Davis/NIH NeuroMab Publications (Link opens in a new window)...
  2. Allen Institute for Brain Science AAV Enhancer Collection

    Type
    Collection
    ...Brain Science AAV Enhancer Collection Plasmids Publications Resources Enhancer AAV plasmids are plasmids...= Substantial non-specific labeling observed Publications Ben-Simon, Y., Hooper, M., Narayan, S., Daigle...
  3. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...Controls To look up a viral vector with the Penn catalog ID: Based on low demand, production of some viral...discontinued. The following viral vectors in the indicated serotypes are no longer available as aliquots....
  4. Zinc Finger Consortium Reagents

    Type
    Collection
    ... and nonprofit laboratories for research and educational use. Links to additional pages describing these...
  5. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Spinocerebellar ataxia 22 Bernard Weinstein 21238 PKC gamma CAT PRKCG HA CMV Spinocerebellar ataxia 21 Bernard Weinstein... HA CMV ALS Catherine Tomasetto 104450 pEGFPC1-hVAP-B KD/MD VAPB GFP, HA CMV ALS Catherine Tomasetto 104465...pmCherryC1 VAP-B VAPB T7-Xpress, mCherry, HA CMV ALS Catherine Tomasetto 226410 pmCherryC1 VAP-B KD/MD VAPB T7... T7-Xpress, mCherry, HA CMV ALS Catherine Tomasetto 226554 pRP.ATM c.7865C>T ATM Flag Ataxia telangiectasia...
  6. AAV Viral Preps

    Type
    Collection
    ...Tools Tetracycline Transactivators, Affinity Purification, Cell Ablation, CRISPR Monosynaptic Neuronal...
  7. Plasmid Collections

    Type
    Collection
    ...resources group plasmids together based on type or application. Browse our guides to find the plasmids and science...
  8. Mammalian RNAi Tools

    Type
    Collection
    ...search our full site . ID Plasmid Vector Type PI Publication Additional Resources Addgene Resources pLKO.1...
  9. CRISPR Plasmids and Resources

    Type
    Collection
    ...fused to deaminases can edit bases in RNA. Other Applications Screen CRISPR libraries are a powerful tool ...
  10. Recombinases AAV Preps

    Type
    Collection
    ...offers you even more options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral...
  11. Chemogenetics AAV Preps

    Type
    Collection
    ...offers you even more options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral...
  12. DNA Quantification

    Type
    Protocol
    ... Protocols DNA Quantification DNA Quantification You may also like... Addgene’s DNA Quantification Protocol. Protocols... to protein (260/280) is generally used as an indicator of the purity of DNA samples. These days, many...
  13. Lentiviral Prep Service

    Type
    Collection
    ... Accessories for Activating Gene Expression Catalytically-dead Cas9 (dCas9) can be fused to a transactivator...
  14. Zebrafish Plasmid Collection

    Type
    Collection
    ...Society (IZFS) - An organization that promotes and advocates for zebrafish research in the international research...
  15. CRISPR Library Amplification

    Type
    Protocol
    ... Protocols CRISPR Library Amplification CRISPR Library Amplification You may also like... Pooled libraries...quantities of library for experimental applications. Repeated amplifications should be avoided as best as possible...Follow this protocol to perform amplification of CRISPR pooled plasmid libraries in Escherichia coli ...refer to our pooled library material pages for amplification protocols that have been developed by the depositor...available. If a pooled library does not yet have an amplification protocol, the following protocol can be used... CRISPR libraries. This protocol allows the amplification of a pooled-plasmid library in Escherichia coli...genes in an organism's genome, for example. Amplification is usually necessary to produce sufficient quantities...
  16. Fluorescent Proteins: FRET

    Type
    Collection
    ...pairs Michael Davidson Lab (Unpublished) FRET Indicators - Live and Fixed Cells Additional Resources at...
  17. Control AAV Preps

    Type
    Collection
    ...offers you even more options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral...
  18. AAV Purification by Iodixanol Gradient Ultracentrifugation

    Type
    Protocol
    .... The arrow indicates the 60–40% interface. The vertical black line indicates the location of the purified... Protocols AAV Purification by Iodixanol Gradient Ultracentrifugation AAV Purification by Iodixanol Gradient...isomolar density gradient medium suitable for virus purification and isolation of cells, organelles, lipoproteins...and use an iodixanol column gradient for AAV purification. Workflow Timeline Day 1: Purify Day 2: Buffer..., et al. "Recombinant adeno-associated virus purification using novel methods improves infectious titer...opens in a new window) . Right panel: cartoon indicating the position of the needle for harvesting of ...
  19. Plasmid Modification by Annealed Oligo Cloning (with Protocols)

    Type
    Protocol
    ... Protocols Plasmid Modification by Annealed Oligo Cloning Plasmid Modification by Annealed Oligo Cloning...' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3'...each of the additional sites in tandem ( NdeI - CATATG , PacI - TTAATTAA , AscI - GGCGCGCC , MfeI - CAATTG...compliment so that they can anneal. Top oligo: 5' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo... final oligos 34 bp each: Top oligo: 5' - AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3...
Showing: 161 - 180 of 1033 results