Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 1,028 results for: ELL

Showing: 161 - 180 of 1028 results

  1. CRISPR Plasmids - Epigenetics

    Type
    Collection
    ... time and are potentially heritable in dividing cells. CRISPR Activate and Interfere technologies also...

  2. Plan Your Experiment

    Type
    Guide
    ...difficult-to-transfect cells. You can direct expression to specific cell types by using cell-specific promoters...human embryonic kidney 293 (HEK293) cells. For more difficult cell types, you may need to look into other...are good choices for more difficult cell types like primary cells. For CRISPR delivery, lentiviral and...deliver to target cells through microinjection or electroporation. The target cells translate the mRNA...complexes directly into your target cells. In this case, your target cells are not transcribing DNA to mRNA...possible genotypes within the resulting cell population. Some cells may remain wild type due to either (1...modifications . Cell Population The first step of validation is determining the type of cell population you...

  3. Adenovirus Guide

    Type
    Guide
    ...enters the host cell, and encode proteins necessary for viral DNA replication and host cell manipulation....expressed by the packaging cell line, normally the human embryonic kidney 293 (HEK293) cell line. There is a rare...transformed into AdEasier-1 cells (Addgene #16399) , which are BJ5183 E. coli cells containing pAdEasy. pAdEasy... construct flanked by ITRs. Cells from the packaging HEK293 or HER911 cell lines expressing E1 are transfected...HER911 cells throughout viral vector production. During experiments, GFP can be used to sort cells infected...transfected into HER911 E4+ cells for rAdV vector production, as HEK293 cells do not contain E4. Download...immune cells and antibody production that develops after exposure to an antigen. AdEasier-1 cells BJ5183...

  5. All Antibodies

    Type
    Collection
    ...application-specific validation and quality control by Addgene as well as by our trusted partner labs. On this page you...

  6. CRISPR Plasmids - gRNAs

    Type
    Collection
    ...is highly recommended that you determine if your cell type contains the target sequence before using any...

  7. CRISPR Plasmids - Cascade-Cas3

    Type
    Collection
    ...bound to DNA, and the break can be repaired by the cell’s endogenous repair mechanisms. Cas3 belongs to the...

  9. Brzezinski Lab CRISPR Collection

    Type
    Collection
    ...enhancers in the retina alters photoreceptor and bipolar cell fate specification, yet differs from deleting both...

  11. Molecular Biology Reference

    Type
    Guide
    ...daughter cells. These daughter cells contain the same genetic information as the parental cell, and are...with the host cell. Like the bacterial chromosomal DNA, plasmid DNA is replicated upon cell division, and...chemistry enable isolation and purification of cellular components, such as DNA, but practically this ...and each daughter cell receives at least one copy of the plasmid. By the 1970s the combined discoveries...are thus termed clones of the original cell. The plasmid DNA is similarly referred to as cloned DNA, and... and ideally would replicate these plasmids upon cell division in addition to their own genomic DNA. Because...additional replication burden, the rate of bacterial cell division is reduced (i.e., it takes more time to...

  12. Resolute Plasmid Collection

    Type
    Collection
    ...the global benefit of basic academic research as well as applied research in small biotech and pharmaceutical...

  13. Chemogenetics Guide

    Type
    Guide
    ...targeted to specific tissues, cell types or even subcellular regions of a neuron. Cell-specific expression of...Human Stem Cell-Derived Neurons Repair Circuits and Restore Neural Function. Cell Stem Cell. 28:112-126...actuators for specific cellular pathways, receptors, or ion channels targeted to specific cell populations (most...signaling, therefore allowing precise control over the cell population they are targeted to. To find chemogenetics...coupled receptors, or GPCRs. The largest class of cell surface receptors, GPCRs are seven-pass transmembrane...stimulating phospholipase C, which releases intracellular calcium stores. There are currently three Gq...and activate neuronal signaling by increasing intracellular cAMP concentrations. There is currently one ...

  14. Guide to Using Pooled Libraries

    Type
    Guide
    ...200x the number of cells as plasmids in the TKO library. Using large numbers of cells minimizes the effects...selection Most cells die or do not pass selection (in the case of a reporter) Sort “winning” cells Sequence ...library Apply selection; most cells will survive Perform NGS on the surviving cells Compare NGS results between...identify those cells that do not survive the selection mechanism. You’ll infect two sets of cells and subject... effects of expressing multiple genes at once. A well-designed screen can help you begin to understand...libraries, plasmid DNA can be delivered directly to the cells of interest. With others, notably pooled lentiviral...subsequently used to deliver the plasmids to the cells of interest. In either case, next-generation sequencing...

  16. Optogenetics Guide

    Type
    Guide
    ...wavelength, the pore opens, cations flow into the cell (yellow dots), and the neuron is activated. Optogenetics...hyperpolarization (inhibition) of the cell when triggered with yellow light, thus inhibiting function of ...that hyperpolarizes (inhibits) the cell when triggered by green-yellow light. Arch Variants. Arch variants...subpopulation of cells within the injection site of the viral vector, rather than in all cells. For example...2010 Molecular and cellular approaches for diversifying and extending optogenetics. Cell. 196:1-28. PMID ...and genetic engineering to measure and manipulate cells (frequently neurons) and their governing biomolecular...detect, measure, and control molecular signals and cells in order to understand their functions. Example ...

  17. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ...and the resulting heteroduplex is resolved by the cell’s mismatch repair (MMR) system. Alternatively, if...

  18. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ... adenovirus expressing a variety of reporters as well as the Cre and Flp recombinases. Genes can be cloned...

  19. Arf GTPase Family

    Type
    Collection
    ...concepts and challenges. Molecular Biology of the Cell , 30 (11), 1249–1271. PMID: 31084567 (Link opens...

  20. Sequencing Primers

    Type
    Guide
    ...Murine stem cell virus, forward primer MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus, reverse...CCCTTGAACCTCCTCGTTCGACC (BD Biosciences) Murine stem cell virus, forward primer pBABE 5' CTTTATCCAGCCCTCAC...IRES, reverse primer L4440 AGCGAGTCAGTGAGCGAG (Caldwell lab) 5' of MCS in L4440 vector, forward primer...LacZ, reverse primer LexA CGTCAGCAGAGCTTCACCATTG (Caldwell lab) 3' end of LexA DNA binding domain, forward...pLXSN 5' CCCTTGAACCTCCTCGTTCGACC (MSCV) Murine stem cell virus, same as MSCV, forward primer pMRB101-F AAGATGCAGGCAGCTGAGTT...
Showing: 161 - 180 of 1028 results