Skip to main content

We narrowed to 15 results for: ELL

Showing: 1 - 15 of 15 results
  1. CRISPR Guide

    Type
    Guide
    ...with Haploid Embryonic Stem Cells Carrying a Guide RNA Library. Cell Stem Cell . 17 (2), 221–232. PMID: ...in the same cell. This is called multiplexing , and increases the likelihood that any cell containing ... the cell along with the gRNA(s) and Cas enzyme. The donor DNA contains the desired edit as well as additional...can increase efficiency. Synchronizing cells or modulating the cell cycle can help as HDR takes place during...expressing stable cell line. After applying your screening conditions to your transduced cell population, you...tracking of RNA in live cells, including orthogonal RNA/DNA labeling in the same cell. Figure 11: Overview...promiscuity is unique to bacterial cells and does not occur in mammalian cells. SHERLOCK , developed by the ...
  2. Lentiviral Vector Guide

    Type
    Guide
    ...production cell line, typically human embryonic kidney 293T (HEK293T) cells. Standard HEK293T cells are sufficient...fluorescence-activated cell sorting (FACS) is used to sort cells expressing GFP and later expanded into a cell line. More...in a variety of cell types and models. Lentiviral vectors can target non-dividing cells, enable stable ...actively dividing cell types, whereas gamma-retroviruses can only infect mitotically active cell types. This...transfected into HEK293T cells using your preferred transfection method. The HEK293T cells will produce the viral..., and Wells et al. (2020) for examples). Pseudotyping Tropism dictates which types of host cells the lentiviral...make stable cell lines, VSV-G is often put under an inducible promoter. Depending on the cell type, there...
  3. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...based on other human cell lines, such as HeLa and A549 cells, and even insect Sf9 cells , have also been ...able to infect cells and replicate autonomously. Human embryonic kidney 293T (HEK293T) cells are the most...HEK293T cells are then extracted and purified for their use as viral vectors to deliver genes to cells in ...persist in non-dividing cells for a period of years without damaging the host cell. Episomal stability allows...broad range of cell types in vivo. AAV-DJ has been optimized further for specific cell and tissue types...co-delivered to the host cells. The full-length transgene is later reconstructed within the cell via different mechanisms... Movement of molecules, vesicles or organelles from the main cell body, or soma, towards the synapse at...
  4. Antibody Guide

    Type
    Guide
    ... produced. Cells - Antibodies can also be produced in cell cultures using hybridomas, cell cultures created...created by fusing B cells with myeloma cells (immortalized B cells). The genetic reorganization that creates...identify and sort cells from a mixed population. Overview of application Collect cells from cell culture or ...specificity occurs in the B cell itself prior to antibody production; therefore, each B cell only produces one ... specific hybridoma cells into plasmids. Plasmids are then transfected into cells and induced to express...determines the isotype of the antibody. B cells, the immune cell responsible for producing antibodies, can...mature B cell can clone itself to enable higher production of a single antibody, but each B cell can only...
  5. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...-activated cell sorting (FACS) is used to sort cells expressing GFP and later, sorted cells are expanded...actively dividing cell types, whereas gamma-retroviruses can only infect mitotically active cell types. This...Using Packaging Cell Lines Gamma-retroviral vectors can be packaged using helper-free cell lines (Figure...-retroviral packaging cell line developed by Garry Nolan at Stanford. These cell lines contain gag-pol...and rat cells), or an amphotropic envelope, Phoenix-AMPHO (for the infection of mammalian cells). Using...make stable cell lines, VSV-G is often put under an inducible promoter. Depending on the cell type, there... — T and B cell transduction Murine Leukemia Virus (MuLV) and HIV glycoprotein — CD4+ cell transduction...
  6. Plan Your Experiment

    Type
    Guide
    ...difficult-to-transfect cells. You can direct expression to specific cell types by using cell-specific promoters...human embryonic kidney 293 (HEK293) cells. For more difficult cell types, you may need to look into other...are good choices for more difficult cell types like primary cells. For CRISPR delivery, lentiviral and...deliver to target cells through microinjection or electroporation. The target cells translate the mRNA...complexes directly into your target cells. In this case, your target cells are not transcribing DNA to mRNA...possible genotypes within the resulting cell population. Some cells may remain wild type due to either (1...modifications . Cell Population The first step of validation is determining the type of cell population you...
  7. Adenovirus Guide

    Type
    Guide
    ...enters the host cell, and encode proteins necessary for viral DNA replication and host cell manipulation....expressed by the packaging cell line, normally the human embryonic kidney 293 (HEK293) cell line. There is a rare...transformed into AdEasier-1 cells (Addgene #16399) , which are BJ5183 E. coli cells containing pAdEasy. pAdEasy... construct flanked by ITRs. Cells from the packaging HEK293 or HER911 cell lines expressing E1 are transfected...HER911 cells throughout viral vector production. During experiments, GFP can be used to sort cells infected...transfected into HER911 E4+ cells for rAdV vector production, as HEK293 cells do not contain E4. Download...immune cells and antibody production that develops after exposure to an antigen. AdEasier-1 cells BJ5183...
  8. Molecular Biology Reference

    Type
    Guide
    ...daughter cells. These daughter cells contain the same genetic information as the parental cell, and are...with the host cell. Like the bacterial chromosomal DNA, plasmid DNA is replicated upon cell division, and...chemistry enable isolation and purification of cellular components, such as DNA, but practically this ...and each daughter cell receives at least one copy of the plasmid. By the 1970s the combined discoveries...are thus termed clones of the original cell. The plasmid DNA is similarly referred to as cloned DNA, and... and ideally would replicate these plasmids upon cell division in addition to their own genomic DNA. Because...additional replication burden, the rate of bacterial cell division is reduced (i.e., it takes more time to...
  9. Chemogenetics Guide

    Type
    Guide
    ...targeted to specific tissues, cell types or even subcellular regions of a neuron. Cell-specific expression of...Human Stem Cell-Derived Neurons Repair Circuits and Restore Neural Function. Cell Stem Cell. 28:112-126...actuators for specific cellular pathways, receptors, or ion channels targeted to specific cell populations (most...signaling, therefore allowing precise control over the cell population they are targeted to. To find chemogenetics...coupled receptors, or GPCRs. The largest class of cell surface receptors, GPCRs are seven-pass transmembrane...stimulating phospholipase C, which releases intracellular calcium stores. There are currently three Gq...and activate neuronal signaling by increasing intracellular cAMP concentrations. There is currently one ...
  10. Guide to Using Pooled Libraries

    Type
    Guide
    ...200x the number of cells as plasmids in the TKO library. Using large numbers of cells minimizes the effects...selection Most cells die or do not pass selection (in the case of a reporter) Sort “winning” cells Sequence ...library Apply selection; most cells will survive Perform NGS on the surviving cells Compare NGS results between...identify those cells that do not survive the selection mechanism. You’ll infect two sets of cells and subject... effects of expressing multiple genes at once. A well-designed screen can help you begin to understand...libraries, plasmid DNA can be delivered directly to the cells of interest. With others, notably pooled lentiviral...subsequently used to deliver the plasmids to the cells of interest. In either case, next-generation sequencing...
  11. Optogenetics Guide

    Type
    Guide
    ...wavelength, the pore opens, cations flow into the cell (yellow dots), and the neuron is activated. Optogenetics...hyperpolarization (inhibition) of the cell when triggered with yellow light, thus inhibiting function of ...that hyperpolarizes (inhibits) the cell when triggered by green-yellow light. Arch Variants. Arch variants...subpopulation of cells within the injection site of the viral vector, rather than in all cells. For example...2010 Molecular and cellular approaches for diversifying and extending optogenetics. Cell. 196:1-28. PMID ...and genetic engineering to measure and manipulate cells (frequently neurons) and their governing biomolecular...detect, measure, and control molecular signals and cells in order to understand their functions. Example ...
  12. Modular Cloning Guide

    Type
    Guide
    ...Expression Tom Ellis DNA parts to create multigene constructs expressed in the cellulose-producing Komagataeibacter...assembly of cellular circuits using Golden Gate-based cloning methods for use in mammalian cells. These can...Yeast Toolkit (MYT) Yeast Expression, CRISPR Tom Ellis 96 plasmids to extend the MoClo-YTK (Dueber) for...MoClo Yeast Toolkit (YTK) to optimize secretion and cell surface display of proteins of interest. Yeast Secrete... Yeast GPCR-sensor Toolkit Yeast Expression Tom Ellis Plasmids for constructing highly-tunable GPCR-based...
  13. Sequencing Primers

    Type
    Guide
    ...Murine stem cell virus, forward primer MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus, reverse...CCCTTGAACCTCCTCGTTCGACC (BD Biosciences) Murine stem cell virus, forward primer pBABE 5' CTTTATCCAGCCCTCAC...IRES, reverse primer L4440 AGCGAGTCAGTGAGCGAG (Caldwell lab) 5' of MCS in L4440 vector, forward primer...LacZ, reverse primer LexA CGTCAGCAGAGCTTCACCATTG (Caldwell lab) 3' end of LexA DNA binding domain, forward...pLXSN 5' CCCTTGAACCTCCTCGTTCGACC (MSCV) Murine stem cell virus, same as MSCV, forward primer pMRB101-F AAGATGCAGGCAGCTGAGTT...
  14. Promoters

    Type
    Guide
    ...describes the specifics of these regions in eukaryotic cells. Core Promoter The core promoter region is located...bind. Histones are proteins found in eukaryotic cells that package DNA into nucleosomes. Histone binding...element controls the rate of transcription. Bacterial cells contain sigma factors which assist the RNA polymerase...ribosomal RNA (rRNA) which is a main component of a cell’s ribosome structure. Ribosomes are the site of protein...
  15. Science Guides

    Type
    Guide
    ...receptors to selectively control and investigate cell signaling pathways. Receptors are remotely controlled...and genetic engineering to measure and manipulate cells (frequently neurons) and their governing biomolecular...detect, measure, and control molecular signals and cells in order to understand their functions. Read More...
Showing: 1 - 15 of 15 results