We narrowed to 165 results for: LOB;
-
TypeGuide...reverse primer Bglob-intron-F CTGGTCATCATCCTGCCTTT Rabbit beta-globin intron, forward primer Bglob-intron-R ...Rabbit beta-globin intron, reverse primer Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region... primer pCAG-F GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids, forward primer pCasper-F...reverse primer XBG-R GACTCCATTCGGGTGTTC Xenopus beta-globin 3'UTR, reverse primer XEF1a TTTCGCCCTAACTTCGTGAT...
-
27 Hot Plasmids from 2016
TypeBlog Post... and toxoplasmosis. Despite their importance to global health, most apicomplexan genes remain uncharacterized... -
Optogenetics Guide
TypeGuide...light-gated inward chloride pumps isolated from halobacteria. Wild-type halorhodopsin, known as NpHR (from...light-driven inward chloride pump from Haloarcula (Halobacterium) salinarum (strain Shark), used to silence neuronal... -
CRISPR Guide
TypeGuide...degradation. This degradation can continue for many kilobases in one or both directions from the target region... variant 5' TYCV AsCpf1 RVR variant 5' TATV Campylobacter jejuni (CJ) 3' NNNNRYAC Neisseria meningitidis... -
Promoters
TypeGuide...regulatory elements such as enhancers several kilobases away from the TSS. Eukaryotic promoters are so...