We narrowed to 183 results for: tTA

...magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 0.1% Crystal Violet, Ward’...indicated serial dilutions of the lentiviral vector pRosetta . The following day, cells were treated with puromycin...

...gently pour off the ethanol storage buffer. Tightly attach LabMate PD10 Buffer Reservoirs to the top of the...columns, refer to the manufacturer’s instructions. Attach the Gravitrap column to a clamp on a clamp stand...

...Pro-Tip While adherent, these cells are very loosely attached to the dish surface and should be handled carefully...magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 1 mg/mL Polyethylenimine (...

...magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 0.45 μm polyethersulfone filter...

... transfected using 1:1, 1:2, 1:3 and 1:6 µg of pRosetta :µg of PEI. The 1:2 and 1:3 ratios provided high...

.... After ligation, the insert DNA is physically attached to the backbone and the complete plasmid can be...

...observations. Some microscopes have digital cameras attached to them that allow you to capture images directly...

...below the 60–40% interface with an 18 ga needle attached to a 10 mL syringe. The bevel of the needle should...

...careful, the pellet is harder to see and less well attached to the tube after the 70% ethanol wash. You can...

...magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 0.45 μm polyethersulfone filter...

...final Reverse Primer sequence of 5’-TGCTTAGCGGCCGCTCAGTACTTCGAGATATGCCA-3’. Experimental Procedure Run PCR...

...gel easier. Cover the electrophoresis chamber and attach to a power supply. Run the gel at 150 V for 1 h...

...magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) Trypsin EDTA (TrypLE, Thermo...

...magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) Trypsin EDTA (TrypLE, Thermo...

...glutathione-S-transferase Forward SP6 ATTTAGGTGACACTATAG SP6 promoter Forward T3 GCAATTAACCCTCACTAAAGG T3 promoter Forward...LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward LNCX AGCTCGTTTAGTGAACCGTCAGATC Human CMV promoter...pcDL-F GTTGCCTTTACTTCTAGGCCT 5' of EcoRI site in pcDL vector Forward pENTR-F CTACAAACTCTTCCTGTTAGTTAG 5' ...Forward Pry1 CTTAGCATGTCCGTGGGGTTTGAAT PZ P-element Reverse pTrcHis Forward GAGGTATATATTAATGTATCG 5' of MCS... Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward M13 Forward (-...CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus Reverse pBABE 5' CTTTATCCAGCCCTCAC Psi packaging signal, 5' of MCS in pBABE vectors... vectors Forward pBAD Forward ATGCCATAGCATTTTTATCC For vectors with E. coli araBAD promoter Forward pBAD...

..., 481–485. PMID: 26098369 Kleinstiver, B. P., Pattanayak, V., Prew, M. S., Tsai, S. Q., Nguyen, N. T.,...PMID: 25398340 Walton, R. T., Christie, K. A., Whittaker, M. N., & Kleinstiver, B. P. (2020). Unconstrained...Daringer, N. M., Freije, C. A., Myhrvold, C., Bhattacharyya, R. P., Livny, J., Regev, A., Koonin, E. V.,... Naito, Y., Nakada, S., Yamamoto, T., Sano, S., Hotta, A., Takeda, J., & Mashimo, T. (2019). CRISPR-Cas3...

...detect simultaneously. Conjugation The process of attaching signaling molecules to an antibody is done through...direct ELISAs, an antigen or protein of interest is attached to the well of a 96-well plate. A conjugated primary...recognize the protein in its native conformation. Attachment of the antibody to the beads is typically done...

...barcode, and amplified. These DNA fragments are attached to a glass slide so that different fragments of..., or templates, are spatially separated. These attached DNA templates are then amplified again, producing...

...amplified with specific Gateway attB1 and attB2 sites attached to the 5’ and 3’ ends of the DNA sequence. This...

... Yeast Expression Brigitte Gasser , Diethard Mattanovich , and Michael Sauer 62 plasmids for advanced ...