We narrowed to 9 results for: tTA

...glutathione-S-transferase Forward SP6 ATTTAGGTGACACTATAG SP6 promoter Forward T3 GCAATTAACCCTCACTAAAGG T3 promoter Forward...LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward LNCX AGCTCGTTTAGTGAACCGTCAGATC Human CMV promoter...pcDL-F GTTGCCTTTACTTCTAGGCCT 5' of EcoRI site in pcDL vector Forward pENTR-F CTACAAACTCTTCCTGTTAGTTAG 5' ...Forward Pry1 CTTAGCATGTCCGTGGGGTTTGAAT PZ P-element Reverse pTrcHis Forward GAGGTATATATTAATGTATCG 5' of MCS... Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward M13 Forward (-...CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus Reverse pBABE 5' CTTTATCCAGCCCTCAC Psi packaging signal, 5' of MCS in pBABE vectors... vectors Forward pBAD Forward ATGCCATAGCATTTTTATCC For vectors with E. coli araBAD promoter Forward pBAD...

..., 481–485. PMID: 26098369 Kleinstiver, B. P., Pattanayak, V., Prew, M. S., Tsai, S. Q., Nguyen, N. T.,...PMID: 25398340 Walton, R. T., Christie, K. A., Whittaker, M. N., & Kleinstiver, B. P. (2020). Unconstrained...Daringer, N. M., Freije, C. A., Myhrvold, C., Bhattacharyya, R. P., Livny, J., Regev, A., Koonin, E. V.,... Naito, Y., Nakada, S., Yamamoto, T., Sano, S., Hotta, A., Takeda, J., & Mashimo, T. (2019). CRISPR-Cas3...

...detect simultaneously. Conjugation The process of attaching signaling molecules to an antibody is done through...direct ELISAs, an antigen or protein of interest is attached to the well of a 96-well plate. A conjugated primary...recognize the protein in its native conformation. Attachment of the antibody to the beads is typically done...

...barcode, and amplified. These DNA fragments are attached to a glass slide so that different fragments of..., or templates, are spatially separated. These attached DNA templates are then amplified again, producing...

...amplified with specific Gateway attB1 and attB2 sites attached to the 5’ and 3’ ends of the DNA sequence. This...

... Yeast Expression Brigitte Gasser , Diethard Mattanovich , and Michael Sauer 62 plasmids for advanced ...

...that bind to the LOV domain only in the dark. attaching only one member of the Zdk/LOV2 pair to the target...

...topics References Ahi, Y. S., Bangari, D. S., & Mittal, S. K. (2011). Adenoviral vector immunity: its ...

...Johnson, N. M., Alvarado, A. F., Moffatt, T. N., Edavettal, J. M., Swaminathan, T. A., & Braun, S. E. (2021...