Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 15 results for: AAVS1

Showing: 1 - 15 of 15 results

  1. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...Tight junction protein ZO-1 Tight junctions 91565 AAVS1-mEGFP AICSDP-35 mEGFP NA Cytoplasm 101781 CETN2-...mEGFP Ras-related protein Rab-5A Endosomes 107580 AAVS1-mTagRFPT-CAAX AICSDP-42 mTagRFPT CAAX domain of ...AICSDP-29 mTagRFPT Lamin B1 Nuclear envelope 114404 AAVS1-mEGFP (PGK) AICSDP-36 mEGFP NA Cytoplasm 114405 ...

  2. Validated gRNA Sequences

    Type
    Collection
    ...Otonkoski AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 58252 cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens...23287722 Church AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 50662 cut S. pyogenes 24336569 Sabatini AAVS1 H. sapiens... 26997482 Yeo AAVS1 H. sapiens TGTCCCTAGTGGCCCCACTG cut S. pyogenes 26789497 Corn AAVS1 H. sapiens ACAGTGGGGCCACTAGGGAC...GGGGCCACTAGGGACAGGAT 70661 cut S. pyogenes 26472758 Sabatini AAVS1 H. sapiens GTCCCCTCCACCCCACAGTG 41817 cut S. pyogenes...GTAGGCGCGCCGCTCTCTAC 71830 methylation S. pyogenes 26969735 Zoldoš AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 72833 cut S. pyogenes...

  5. CRISPR Plasmids - Tagging

    Type
    Collection
    ...targeting the AAVS1 locus. Doyon Tagging Plasmid: 3xFLAG-2xSTREP Construct for integrating at the AAVS1 "safe ...cloned directly into this vector and targeted to the AAVS1 genomic safe harbor locus using untagged SpCas9 ...Addgene 41815 or #44719 ) in combination with gRNA_AAVS1-T2 (Addgene #41818) or using an all in one vector...vector from the Doyon lab, eSpCas9(1.1)_No_FLAG_AAVS1_T2 (Addgene #79888) , which expresses an untagged...safe harbor" locus: eSpCas9(1.1)_No_FLAG_AAVS1_T2 Doyon Lab TAP Tagging Protocol 97.2 KB Yamamoto PITCh Tagging...

  9. Viral Vectors 101: Virus Safety

    Type
    Blog Post
    ...though it can integrate at chromosome 19q13.4 qtr. (AAVS1)). For these reasons, AAV is usually classified ...

  11. Tetracycline Inducible Expression

    Type
    Collection
    ...System. Contains homology arms for integration into AAVS1 Genomic Safe Harbor Locus. Tet-On 3G On Doyon 58245... interest. tTA Off Sabatini 92099 AAVS1_Puro_Tet3G_3xFLAG_Twin_Strep Bidirectional promoter controls expression...

  12. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...integrating into the host genome at a specific site, the AAVS1 site on human chromosome 19. This integration is...Rep-binding elements present in the AAV ITRs and the AAVS1 site. Since the Rep region is removed from the rAAV...

  13. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...lines by inserting OsTIR1 into the "safe harbor" AAVS1 locus (a tet-inducible OsTIR1 plasmid is also available...

  15. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...SLC1A3 Episodic ataxia Giulio Superti-Furga 132389 AAVS1 CAG rtTA3 TauWT 2N4R-EGFP MAPT GFP TREtight Parkinson's...Parkinson's, FTD Gerold Schmitt-Ulms 132393 AAVS1 CAG rtTA3 TauP301L 2N4R-EGFP MAPT GFP TREtight Parkinson's...
Showing: 1 - 15 of 15 results