We narrowed to 18 results for: CAG synthetic promoter

...interest. Promoter The promoter drives the expression of the AAV transgene. On a plasmid map, promoters are ...location. Promoters can also drive different levels of expression. For example, CAG is a strong promoter that...synapsin 1 promoter is neuronal specific (Haery et al., 2019). Most AAV transfer plasmids have a promoter, but...considerations for the perfect AAV tool Learn about synthetic promoter AAVs for cell-type expression in retinal ...are upstream or 5’ of the gene they control. Promoters can be organism or tissue type-specific, which can...nuclear export of RNA and RNA translation, and promotes RNA transcript longevity. The polyA is located...

...have created synthetic promoters, which typically include some combination of other promoter elements, and... trying to pick your perfect promoter! Eukaryotic Promoters   Promoter   Primarily used for RNA     ...commonly used in promoter hybrids. CAG General expression mRNA Strong hybrid mammalian promoter Constitutive.... In practice, the term "promoter" describes the combination of the promoter (RNA polymerase binding site...recognize and bind to specific promoter elements. This means that the promoter present in your plasmid backbone...RNAP II promoter, whereas small RNAs (such as shRNA) are transcribed from the RNAP III promoters. This ...post on viral vector parts. Promoter specificity Aside from choosing a promoter based on type of RNA transcript...

...fluorescent proteins, 8 constitutive promoters, 2 includible promoters, 3 polyA terminators and various pieces...sequences. Several pre-constructed promoter-selection marker or promoter-inducible expression related vectors...all chemically inducible promoters; 3) improving the strength of the promoters used; and 4) optimizing ...ideal promoter/location combination. However, other constructs which contain different promoters and/or...to study the human GM-CSF promoter and enhancer, a finely regulated promoter controlled by a mixture of...multiple copies of a transcription factor to a promoter and localization of a protein via the presence...after the "stellar explosion SUperNova", is a synthetic scaffold that recruits up to 24 copies of a protein...

...either the Thy1 or CAG promoter, while Brainbow AAV is under control of the EF1a promoter. Livet et al....transposon and vector systems and creating an all-synthetic vector that included only the elements needed ...known as SpyLigase and is a protein domain that promotes the formation of an isopeptide bond between 2 ...-to-clone sequences and rapid construction of synthetic biological systems” as they predict. The pOSIP...protocols, and more. MoClo modular cloning system Synthetic biologists have developed a modular cloning strategy...insert fragments of DNA containing basic parts (promoters, UTRs, coding sequences, terminators, etc) into... creating a single transcriptional unit (Ex: a promoter, 5’UTR, coding region, and terminator). Next, ...

...and Tol2.  Sleeping beauty Sleeping Beauty is a synthetic transposable element developed from inactivated...integration is TA dinucleotides and it leaves behind the CAG DNA footprint from its terminal sequences at the ...example, piggyBac and Tol2 are best for screening promoters and enhancers since they are biased to insert ...

... gRNA from a Drosophila U6:2 promoter and Cas9 from the actin 5C promoter. Addgene’s fly library web page... over 30 promoters and 140 genes, including constructs with unique tissue-specific promoters expressing...genomic libraries are cloned downstream of a minimal promoter sequence. Should one of these random stretches...activate its own transcription from the minimal promoter and its strength can be determined from its enrichment...PubMed PMID: 18165312 CIDAR MoClo parts kit Synthetic and basic biologists alike often need to test ...variety of plasmids containing many different promoters, RBS’, coding sequences (CDS), and terminators...fluorophores, generate expression vectors with various promoters suitable for in vivo expression, and/or produce...

...Viviana Gradinaru 104102 pCAG-tTA Mammalian expression of tTA from the CAG promoter for Tet-Off tTA-Advanced...upstream of a minimal CMV promoter, and other tet- or dox-dependent promoters (sometimes generally called... CMV promoter. In the absence of tetracycline, tTA binds to the TRE and its VP16 domain promotes gene ...transactivators and promoters are generally cross-compatible. Your choice of transactivator, promoter, and type ...from EF1α promoter, for Tet-Off. See Plasmid #27106 for rtTA. tTA Edward Hsiao 99118 pAAV-CAG-tTA AAV Tet-Off... Tet-Off vector, expresses tTA from the CAG promoter. See article ( Chan et al., 2017 ) for other viral...Additional Resources Blog: Inducible Promoters Blog: Repressible Promoters Mammalian shRNA Plasmids Cre-lox...

...toolbox, they screened antibody candidates using a synthetic human scFV library and characterized them by ELISA...to measure time. These plasmids with different promoters driving expression of Cas9 were used in this study...ready-to-use AAV vectors expressing GCaMP6f with this promoter. Image calcium transients in PV interneurons with...-2 Recombinant antibodies for aminoacyl tRNA synthetases Nanocompartments for yeast bioproduction pathways...recombinant antibody toolbox for aminoacyl tRNA synthetases By Kate Harten Recombinant antibodies targeting...targeting fourteen aminoacyl tRNA synthetases (aaRS) have been created, characterized, and validated by the... Because many aaRSs exist within a multi-tRNA synthetase complex, the team investigated whether the generated...

... Synthetic Biology SynBio Guide Synthetic Biology: Assembly...combine components for synthetic biology research. Synthetic...Genome Engineering A distinguishing feature of synthetic biology is the ease with which parts can be combined.... Therefore, the same reaction which ligates a promoter into an empty backbone can be repeated to ligate...ligate your gene of interest after the promoter, and so on. The following table provides information for...popular cloning strategies for the assembly of synthetic parts include Gibson assembly and type IIS systems... EcoR1 , NotI , XbaI Suffix: T ACTAGT A GCGGCCG CTGCAG Suffix Enzymes: SpeI , NotI , PstI Scar: TACTAGAG...

...containing promoters that drive general and species-specific gene expression. Cloning and Synthetic Biology...for, such as the promoter or cloning method of choice. ID Plasmid Description Promoter Cloning Method PI...OpenPlant Synthetic Biology Research Centre (Link opens in a new window) — The initiative promotes interdisciplinary... PI Synthetic Biology Kits The following plasmid kits and collections are designed for creating plant ... Lohmann 1000000076 GoldenBraid 2.0 Kit Plant synthetic biology kit for GoldenBraid cloning and multigene...chloroplast-specific genetic modules for Golden-Gate cloning of synthetic operons into chloroplast transformation vectors...GreenGate) Wayne Parrott Additional Cloning and Synthetic Biology Resources Improved Gateway binary vectors...

...Chien lab (Kwan et al., 2007) and includes four promoters, six fluorophores with nonoverlapping emission...neurodegenerative diseases, the Cole Lab selected promoters for cell types directly linked to disease, including...The Dorus Gadella lab has recently developed a synthetic red fluorescent protein variant they call mScarlet... components can be controlled by a variety of promoters for versatile and robust engineering. These components...enzymatic activity. In addition, proteins can be “caged” by fusion to specific domains thereby rendering... The authors use PhoCl in combination with this caging technique to beautifully demonstrate light-dependent...

...nuclease-dead Cas9 (dCas9) is directed near the promoter of a target gene. Here, the target window is not...a gRNA, as the method of producing the guide (synthetic, in vitro transcription, or lentiviral delivery... shown that the FANTOM database, which relies on CAGE-seq to directly capture the mRNA cap, provides the...

...be activated by synthetic ligands. Specifically, Receptors Activated Solely by Synthetic Ligands (RASSLs...commercially available. Table 4: Common promoters in chemogenetics plasmids Promoter Cell Specificity hSyn1, CaMKIIa...controlled with cell-type specific promoters. Table 4 lists some common promoters found in chemogenetic receptor... 1998). These receptors were activated by the synthetic ligand spiradoline, however, spiradoline exhibited... GFAP Glia CD68 Microglia Dlx Interneurons EF1a, CAG General expression Targeted Expression Depending ...

... directed differentiation of human cells with synthetic modified mRNA. Cell Stem Cell, 2010. 7(5): p. ...iPSC-derived osteoblasts and osteoclasts together promote bone regeneration in 3D biomaterials. Sci Rep, ... damage results in the transdifferentiation of glucagon-producing α-cells into insulin-producing β-like-cells...

...numerous high-frequency off-target sites in the HBG promoter that were missed by standard workflows, highlighting...high APOBEC3B tumors as potential targets for synthetic lethal therapeutic strategies. Sarat Chandarlapaty...off-targets remains challenging. Siyuan Zou (U. Chicago) presented Inrich-seq, a method that captures the...

...downstream from a promoter to drive expression of the inserted gene. Insert The gene, promoter, or other DNA...particular plasmid. Promoter Region Drives transcription of the insert. The promoter recruits transcriptional...strength of the promoter can control the level of insert expression, as a strong promoter directs high expression...weaker promoters can direct low/endogenous expression levels. For more information about promoters, check...resources, including: Molecular Cloning Techniques Promoters Sequencing Primers Origins of Molecular Genetics...code by redirecting some codons to encode for synthetic amino acids. Plasmids and Recombinant DNA Technology... for a variety of studies used to investigate promoters, small RNAs, and other genetic elements. Plasmid...

...vectors with AOX1 promoter Forward 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter Forward AC5 ACACAAAGCCGCTCCATCAG...araBAD promoter Forward pBAD Reverse GATTTAATCTGTATCAGG For vectors with E. coli araBAD promoter Reverse... shock promoter Forward EF-1α Forward TCAAGCCTCAGACAGTGGTTC Human elongation factor-1α promoter Forward...GACTATCATATGCTTACCGT Human U6 promoter Forward LNCX AGCTCGTTTAGTGAACCGTCAGATC Human CMV promoter Forward Luc-F AGTCAAGTAACAACCGCGA...Mouse metallothionein 1 promoter Forward mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter Forward Myc GCATCAATGCAGAAGCTGATCTCA...Nopaline synthase promoter Forward Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe nmt1 promoter Forward OpIE2 Forward...

... MCH2, MCH2R, SLT MDK midkine (neurite growth-promoting factor 2) FLJ27379, MK, NEGF2 MET met proto-oncogene...assembly of constructs that are optimized for synthetic biology applications in mammalian systems. The... different fluorescent proteins, 10 mammalian promoters and enhancers, 3 polyA signals as well as selection...receptor 3 - GAST gastrin GAS GCG glucagon GLP1, GLP2, GRPP GCGR glucagon receptor GGR, MGC138246 GDF1 growth...MGC70354, foveolin GLP1R glucagon-like peptide 1 receptor MGC138331 GLP2R glucagon-like peptide 2 receptor...