Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 20 of 22 results
  1. New and Upcoming Viral Vectors - December 2019

    Type
    Blog Post
    ...lab, which includes pAAV-hSyn Con/Fon hChR2(H134R)-EYFP that is both Cre and Flp dependent. Plasmid Serotype...mScarlet-KV2.1 55645 AAV5 pAAV-hSyn Con/Fon hChR2(H134R)-EYFP 26975 AAVrg pAAV-CaMKIIa-hChR2(H134R)-mCherry ...H134R)-mCherry 26973 AAVrg pAAV-hSyn-hChR2(H134R)-EYFP   Control AAV Control AAV allow researchers to...Nuc-flox(mCherry)-EGFP 27056 AAVrg pAAV-Ef1a-DIO EYFP 50457 AAV2 pAAV-hSyn-DIO-EGFP   Biosensor AAV...pAAV-hSyn-DIO-mCherry 27056 AAVrg pAAV-Ef1a-DIO EYFP 114471 AAV5 pAAV-Ef1a-fDIO mCherry 112677 AAV2...
  2. Advanced Uses of Cre-lox and Flp-FRT - A Neuroscientist’s View

    Type
    Blog Post
    ...Figure 1: Plasmid mix to label neuronal morphology (eYFP) and the synaptic protein PSD95 (PSD95-mcherry) ...expressing fluorescent cytoplasmic markers (e.g. eYFP) and synaptic proteins (e.g. postsynaptic PSD95-... Figure 2: Expression of a morphological marker (eYFP) and synaptic marker (PSD95-mcherry), under the ...
  3. New and Upcoming Viral Vectors - September 2019

    Type
    Blog Post
    ...to access them! Controls pAAV-hSyn-hChR2(H134R)-EYFP (26973-AAVrg) pAAV-hSyn-hChR2(H134R)-mCherry (26976...AAVrg) Optogenetics pAAV-hSyn Con/Fon hChR2(H134R)-EYFP (55645-AAV5)  Additional resources on the Addgene...
  4. Hot Plasmids - October 2022

    Type
    Blog Post
    ...+ and other cations. B) Cortical slice of HcKCR1-EYFP and tdTomato expressed layer 2/3 neurons in mouse...
  5. Optogenetics AAV Preps

    Type
    Collection
    ...ChETA-EYFP EF1a ChETA EYFP Cre dependent 1, 5, 9 Deisseroth 35497 pAAV-Ef1a-DIO C1V1 (t/t)-TS-EYFP EF1a...t/t) EYFP Cre dependent 9 Deisseroth 35499 pAAV-CaMKIIa-C1V1 (t/t)-TS-EYFP CaMKII C1V1 (t/t) EYFP Constitutive...Arch3.3-EYFP nEF Arch3.3 EYFP Cre dependent 8 Deisseroth 137150 pAAV-nEF-Coff/Fon-Arch3.3-p2a-EYFP nEF Arch3.3...floxed-eNpHR-EYFP-WPRE-pA EF1a eNpHR EYFP Cre dependent 9 Deisseroth 26966 AAV-Ef1a-DIO eNpHR 3.0-EYFP EF1a eNpHR...3.0 EYFP Constitutive 1, 9 Deisseroth 26972 pAAV-hSyn-eNpHR 3.0-EYFP Syn eNpHR 3.0 EYFP Constitutive 5 Deisseroth...pAAV-nEF-NpHR3.3-EYFP nEF NpHR 3.3 EYFP Constitutive 8 Deisseroth 137152 pAAV-nEF-Con/Fon-NpHR3.3-EYFP nEF NpHR...3.3 EYFP Cre dependent 8 Deisseroth 137154 pAAV-nEF-Coff/Fon-NpHR3.3-EYFP nEF NpHR 3.3 EYFP Flp dependent...
  6. Deisseroth INTRSECT Collection

    Type
    Collection
    ...-fDIO EYFP Flp 55640 pAAV-Ef1a-dDIO hChR2(H134R)-EYFP Dre 55639 pAAV-Ef1a-fDIO hChR2(H134R)-EYFP Flp 126080...proof-of-concept targeting approach in 2014 1 (using EYFP and ChR2-EYFP as payloads). This approach has been broadly...mouse and rat lines. Plasmids In addition to EYFP and ChR2-EYFP, a large number of additional, validated ...pAAV-Ef1a-sCreDIO hChR2(H134R)-eYFP Scre 126081 pAAV-Ef1a-vCreDIO hChR2(H134R)-eYFP Vcre Dual recombinase-dependent...Mutations 55650 pAAV-hSyn Con/Fon EYFP Cre AND Flp 55651 pAAV-hSyn Con/Foff EYFP Cre AND NOT Flp F3/F5 137162...pAAV-Ef1a-Con/Foff 2.0-EYFP Cre AND NOT Flp FRT/F5 55652 pAAV-hSyn Coff/Fon EYFP Flp AND NOT Cre 137129... Con/Fon hChR2(H134R)-EYFP Cre AND Flp 55644 pAAV-nEF Con/Fon hChR2(H134R)-EYFP Cre AND Flp 55647 pAAV-nEF...
  7. Control AAV Preps

    Type
    Collection
    ...Foff 2.0-EYFP EF1a EYFP Cre dependent 8 Deisseroth 137164 pAAV-nEF-Con/Fon/Von eYFP nEF EYFP Cre, Flp ... EGFP Constitutive 5 Haydon 104055 pAAV-CAG-eYFP CAG EYFP Constitutive 2, 5, rg*, PHP.eB Gradinaru 104061... 1, 2, 5, 8, 9, rg* Deisseroth 117382 hSyn1-eYFP hSyn eYFP Constitutive 5, 8, 9, rg*, PHP.eB Gradinaru...Cre-dependent expression 27056 pAAV-Ef1a-DIO EYFP EF1a EYFP Cre dependent 1, 2, 5, 9, rg* Deisseroth 28306... dependent 1 Wickersham 104052 pAAV-CAG-DIO-EYFP CAG EYFP Cre dependent PHP.V1 Gradinaru 83895 pAAV-hDlx-Flex-GFP-Fishell..., 8, 9, rg* Deisseroth 55641 pAAV-Ef1a-fDIO EYFP EF1a EYFP Flp dependent 1, 2, 9 Deisseroth 128434 pAAV-Ef1a-fDIO-tdTomato...INTRSECT Constructs 55650 pAAV-hSyn Con/Fon EYFP hSyn EYFP Cre and Flp dependent 8, rg* Deisseroth 137129...
  8. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...pAAV-Ef1a-DIO ChETA-EYFP Karl Deisseroth AV-1-26969P 26969-AAV1 pAAV-CaMKIIa-hChR2(H134R)-EYFP Karl Deisseroth...pAAV-CaMKIIa-eNpHR 3.0-EYFP Karl Deisseroth AV-1-26973P 26973-AAV1 pAAV-hSyn-hChR2(H134R)-EYFP Karl Deisseroth...pAAV-Ef1a-DIO eNpHR 3.0-EYFP Karl Deisseroth AV-5-26968P 26968-AAV5 pAAV-Ef1a-DIO ChETA-EYFP Karl Deisseroth ...pAAV-CaMKIIa-hChR2(H134R)-EYFP Karl Deisseroth AV-5-26972P 26972-AAV5 pAAV-hSyn-eNpHR 3.0-EYFP Karl Deisseroth ...floxed-eNpHR-EYFP-WPRE-pA Karl Deisseroth AV-9-26966P 26966-AAV9 pAAV-Ef1a-DIO eNpHR 3.0-EYFP Karl Deisseroth...pAAV-CaMKIIa-hChR2(H134R)-EYFP Karl Deisseroth AV-9-26971P 26971-AAV9 pAAV-CaMKIIa-eNpHR 3.0-EYFP Karl Deisseroth...pAAV-CaMKIIa-C1V1 (t/t)-TS-EYFP Karl Deisseroth AV-9-35505 35505-AAV9 pAAV-CaMKIIa-hChR2(E123A)-EYFP Karl Deisseroth...
  9. Brain Initiative Collection

    Type
    Collection
    ...-CAG-DIO-EYFP An AAV genome encoding Cre-dependent expression of the fluorescent protein EYFP from the...AAV2 pAAV-CAG-eYFP An AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG ...AAVrg pAAV-CAG-eYFP An AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG ...PHPeB pAAV-CAG-eYFP An AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG ...Boyden 117382-AAV2 hSyn1-eYFP An AAV genome that expresses the fluorescent protein eYFP from the hSyn1 promoter...Gradinaru 117382-AAV5 hSyn1-eYFP An AAV genome that expresses the fluorescent protein eYFP from the hSyn1 promoter...Gradinaru 117382-AAV8 hSyn1-eYFP An AAV genome that expresses the fluorescent protein eYFP from the hSyn1 promoter...
  10. Retrograde AAV viral preps

    Type
    Collection
    ...Fon/Von eYFP nEF EYFP, Cre, Flp and VCre-dependent Control Deisseroth 117382 hSyn1-eYFP Syn EYFP Control...Cre-dependent Control Roth 55650 pAAV-hSyn Con/Fon EYFP Syn EYFP, Cre and Flp-dependent Control Deisseroth 28306...Cre-dependent Control Boyden 27056 pAAV-Ef1a-DIO EYFP EF1a EYFP, Cre-dependent Control Deisseroth 114470 pAAV-Ef1a-mCherry...Dlx dTomato Control Fishell 104055 pAAV-CAG-eYFP CAG EYFP Control Gradinaru 112677 pOTTC1032 - pAAV EF1a... 3.0-EYFP EF1a Inhibitor, Cre-dependent Optogenetics Deisseroth 26973 pAAV-hSyn-hChR2(H134R)-EYFP Syn ...Deisseroth 20298 pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA EF1a Activator, Cre-dependent Optogenetics... Deisseroth 55645 pAAV-hSyn Con/Fon hChR2(H134R)-EYFP Syn Activator, Cre and Flp-dependent Optogenetics...
  11. Fluorescent Protein Guide: FRET

    Type
    Collection
    ... EYFP connected by 8 GGSGGS repeats pET28CLY9 Peptide linker standard consisting of ECFP and EYFP connected...pET28CLY1 Peptide linker standard consisting of ECFP and EYFP connected by 1 flexible glycine- and serine-containing...pET28CLY2 Peptide linker standard consisting of ECFP and EYFP connected by 2 GGSGGS repeats pET28CLY3 Peptide ...Peptide linker standard consisting of ECFP and EYFP connected by 3 GGSGGS repeats pET28CLY4 Peptide linker standard... standard consisting of ECFP and EYFP connected by 4 GGSGGS repeats pET28CLY5 Peptide linker standard ...standard consisting of ECFP and EYFP connected by 5 GGSGGS repeats pET28CLY6 Peptide linker standard consisting...consisting of ECFP and EYFP connected by 6 GGSGGS repeats pET28CLY7 Peptide linker standard consisting of ECFP...
  12. Caltech Systemic Capsids

    Type
    Collection
    ...Dlx mRuby2 Control Gradinaru 104055 pAAV-CAG-eYFP CAG EYFP Control Gradinaru 104061 CAG-NLS-GFP CAG NLS-GFP...EF1a mCherry Control Deisseroth 117382 hSyn1-eYFP Syn EYFP Control Gradinaru 135630 pAAV-S5E2-dTom-nlsdTom...pAAV-hSyn-hChR2(H134R)-EYFP Syn Activator ChR2 Deisseroth 20298 pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA...-ChR2(H134R)-eYFP CAG Activator, Cre-dependent ChR2 Gradinaru 135633 pAAV-S5E2-C1V1-eYFP E2 regulatory...Description Category PI 104052 pAAV-CAG-DIO-EYFP CAG EYFP, Cre-dependent Control Gradinaru MaCPNS1 These...
  13. Hot Plasmids - August 2020

    Type
    Blog Post
    ...syn-FLEX-axon-jYCaMP1s. Find these AAVs at Addgene Cre-dependent EYFP AAV in the new serotype PHP.V1 that exhibits efficient...
  14. AAV Molecular Tools

    Type
    Collection
    ...TRE-DIO-eYFP Cre-dependent and Tetracycline-inducible Cre-dependent, Tet-inducible expression of EYFP 1 Gradinaru...
  15. Sequencing Primers

    Type
    Guide
    ...Golenbock lab) For distinguishing EGFP vs ECFP vs EYFP, reverse primer F1ori-F GTGGACTCTTGTTCCAAACTGG F1...
  16. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...nm) Brightness pKa Maturation Structure Plasmids EYFP 513 527 51 6.9 Prone to dimerization pcDNA3-YFP ...Vectors - Gateway cloning; includes tagging with ECFP, EYFP, DsRed, Cerulean Bacteria Gradia Lab Bacterial Vectors...
Showing: 1 - 20 of 22 results