Skip to main content
Addgene

We narrowed to 6 results for: GL3

Showing: 1 - 6 of 6 results
  1. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...widely used luciferase reporter gene plasmid pGL3 pGL3 luciferase reporter gene plasmids have been ... and Woods in the nineties. However, reliance on pGL3 has not been without problems due to the high rate...pXPG, which shows lower background expression than pGL3, enabling its use for the study of promoters with...pXPG contains the Luc+ luciferase gene derived from pGL3 but has a distinct advantage over the latter plasmid... the synthetic polyadenylation signal present in pGL3. This appears to contribute to more efficient blocking...
  2. Luciferase Plasmid Collection

    Type
    Collection
    ... Plasmid Luciferase Type(s) Description PI 64784 pGL3-Basic-IRES Firefly Insertion of 5' promoter/enhancer...cytoplasm of mammalian cells Peter Cockerill 212936 pGL3 Basic Vector Firefly Vector for investigating regions...fusions in Drosopholia Michael Rosbash 128046 pGL3basic luciferase and renilla_polyA Firefly, Renilla ...present for normalization. Alejandro Ferrando 114670 pGL3-TK-5UTR-BsmBI-Luciferase Firefly Insertion of 5'...
  3. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Ristow 14978 pGL3-basic-hFX-promotor(1kb) FXN hFXN Friedreich ataxia Michael Ristow 14979 pGL3-basic-hFX-...Ristow 14980 pGL3-basic-hFX-promotor(2,5kb) FXN hFXN Friedreich ataxia Michael Ristow 14981 pGL3-basic-hFX-promotor...Schroer 51435 pGL3Basic_ME.1/ApoEpromoter APOE ApoE Alzheimer's Sohail Tavazoie 51436 pGL3Basic-ME.2/ApoEpromoter...Yildiz 159787 pGL3-U6-pegRNA_KCNA1-EGFP KCNA1 U6 Episodic ataxia Xiaolong Wang 159788 pGL3-U6-sgRNA_KCNA1...
  4. Validated gRNA Sequences

    Type
    Collection
    ...GGACTTTTGCCAGCCATGGT 52255 cut S. pyogenes 23929339 Sheen pGL3-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA...
  5. Sequencing Primers

    Type
    Guide
    ...RVprimer3 CTAGCAAAATAGGCTGTCCC (Promega) 5' of MCS in pGL3 vector, forward primer SFFV-F ATTGATTGACTGCCCACCTC...
Showing: 1 - 6 of 6 results