Skip to main content
Addgene

We narrowed to 19 results for: Gfap

Showing: 1 - 19 of 19 results
  1. Hot Plasmids: Summer 2024

    Type
    Blog Post
    ...type. For example, glial fibrillary acidic protein (GFAP) is a glia-specific intermediate filament expressed...Neuroscience Antibody Collection to find a recombinant anti-GFAP [N206A/8R] antibody shared by James Trimmer’s lab...types in the nervous system!  Find recombinant anti-GFAP [N206A/8R] antibody here!   Figure 5: Free-floating...Free-floating rat brain sections stained with Anti-GFAP. The staining patterns from recombinant antibodies...
  2. New Viral Vectors - Fall 2024

    Type
    Blog Post
    ...AAV1 Biosensors Yulong Li New viral prep pGP-AAV-GFAP-iGABASnFR2-WPRE AAV1, AAV5 Biosensors GENIE Project...New viral prep with multiple serotypes pGP-AAV-GFAP-iGABASnFR2(no bind)-WPRE AAV1, AAV5 Biosensors GENIE...
  3. Viral Vectors 101: AAV Variables That Matter

    Type
    Blog Post
    ...as synapsin, glial fibrillary associated protein (GFAP), or tyrosine-hydroxylase (TH), can limit which ...Astrocyte-selective AAV gene therapy through the endogenous GFAP promoter results in robust transduction in the rat... & Brenner, M. (2004). Expression specificity of GFAP transgenes. Neurochemical Research, 29(11 SPEC. ...
  4. Chemogenetics AAV Preps

    Type
    Collection
    ...50478 pAAV-GFAP-hM3D(Gq)-mCherry hM3D(Gq) - Activation mCherry fusion none 5 Roth 50479 pAAV-GFAP-hM4D(Gi...DREADD PSAM4 GlyR Promoter Synapsin CaMKIIa CD68 Dlx GFAP nEF CAG E2 regulatory element Tag Fusion tags mCherry...Activation NLS-dTomato none 1, 9, rg* Fishell 50472 pAAV-GFAP-HA-rM3D(Gs)-IRES-mCitrine rM3D(Gs) - Activation ...
  5. Biosensor AAV Preps

    Type
    Collection
    ...pGP-AAV-GFAP-iGABASnFR2-WPRE GFAP iGABASnFR2 none Constitutive 1, 5 GENIE 218873 pGP-AAV-GFAP-iGABASnFR2...Constitutive 1, 5, 9 Looger 98930 pENN.AAV.GFAP.iGluSnFr.WPRE.SV40 GFAP iGluSnFr none Constitutive 1, 5,...none Cre dependent 1 Looger 106192 pAAV.GFAP.SF-iGluSnFR.A184S GFAP SF-iGluSnFR.A184S none Constitutive... Sensors GRAB_5-HT Promoter CAG CaMKIIa Dlx EF1a GFAP/GfaABC1D Synapsin E2 regulatory element Activity...pGP-AAV-GFAP-iGABASnFR2(no bind)-WPRE GFAP iGABASnFR2 (control) none Constitutive 1, 5 GENIE 218874 pGP-AAV-syn-iGABASnFR2...
  6. The Pleiades Promoter Project

    Type
    Collection
    ... EGFP/NLS Ple88 GFAP pEMS1375 EGFP/NLS Ple88 GFAP pEMS1559 intron-lacZ/NLS Ple89 GFAP pEMS1376 EGFP/NLS...NLS Ple90 GFAP pEMS1121 EGFP/cre/NLS Ple90 GFAP pEMS1377 EGFP/NLS Ple92 GPR88 pEMS1160 EGFP/NLS Ple93 ...
  7. Control AAV Preps

    Type
    Collection
    ...TurboRFP Constitutive 1, 8 Wilson 105549 pAAV.GFAP.eGFP.WPRE.hGH GFAP EGFP Constitutive 5 Wilson 105552 pENN.AAV.hSyn.TurboRFP.WPRE.RBG... AAV9-X1.1 Promoter CAG CaMKIIa CMV Dlx EF1a/nEF GFAP and variants Synapsin TBG Other Fluorophore/Tag ...tdTomato Constitutive 5 Zeng 58909 pAAV-GFAP104-mCherry GFAP104 mCherry Constitutive 5 Boyden 59462 pAAV-CAG-tdTomato...
  8. Recombinases AAV Preps

    Type
    Collection
    ....cTNT.iCre cTnT tdTomato 9 Pu 105550 pAAV.GFAP.Cre.WPRE.hGH GFAP none 5, PHPeB Wilson 196410 AAV-GfaABC1D-Cre...
  9. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...Laforin Human Mouse IgG2a 114536 Anti-GFAP R416WT [N206B/9R] GFAP R416WT Human Mouse IgG2a 114538 Anti-...] Frataxin Human Mouse IgG2a 177512 Anti-GFAP [N206A/8R] GFAP Human Mouse IgG2a 177513 Anti-LRP4 (extracellular...-2b] RGS14 Rat Mouse IgG2b 199410 Anti-GFAP [N206A/8R-2b] GFAP Human Mouse IgG2b 199412 Anti-Cav1.2 Ca2...Neurexin-1-Beta Human Mouse IgG1 206703 Anti-GFAP [N206A/8R-1] GFAP Human Mouse IgG1 206705 Anti-Cav1.2 Ca2.../Rat rat IgG2a 225421 GFAP (Homo sapiens) recombinant monoclonal antibody. GFAP Human Chimera: Mouse/Rat...Neurexin-1-Beta Human Mouse 199426 GFAP scFv [N206A/8] N206A/8 scFv GFAP Human Mouse 199428 MAP3K12 scFv ...
  10. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ...microglial/macrophage (mpeg1.1), and astrocytic (gfap).This toolbox adds new neuronal tools to the expanding...
  11. Chemogenetics Guide

    Type
    Guide
    ...Promoter Cell Specificity hSyn1, CaMKIIa Neurons GFAP Glia CD68 Microglia Dlx Interneurons EF1a, CAG General...
  12. Caltech Systemic Capsids

    Type
    Collection
    ...Cre-EGFP expression Cre Wilson 105550 pAAV.GFAP.Cre.WPRE.hGH GFAP Cre-expression Cre Wilson 107738 pAAV-hSyn-Cre-P2A-dTomato...
  13. Validated gRNA Sequences

    Type
    Collection
    ...TGGTCCGTCTAGAAACTCGGTAC 64159 activate S. pyogenes 25619936 Sato gfap D. rerio GTGCGCAACACATAGCACCA 65566 cut S. pyogenes...
  14. New and Upcoming Viral Vectors - Spring 2019

    Type
    Blog Post
    ... [Archon1-KGC-GFP-ER2] pAAV-FLEX-tdTomato pAAV-GFAP104-mCherry pAAV-mDlx-NLS-mRuby2 CAG-NLS-GFP pAAV-hSyn-mCherry...molecular tool.   Find pAAV-FLEX-tdTomato, pAAV-GFAP104-mCherry, pAAV-mDlx-NLS-mRuby2, CAG-NLS-GFP,and ...
  15. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...Douglas Kim AV-1-PV2914 98930-AAV1 pENN.AAV.GFAP.iGluSnFr.WPRE.SV40 Biosensor Loren Looger AV-1-PV3080...Douglas Kim AV-5-PV2914 98930-AAV5 pENN.AAV.GFAP.iGluSnFr.WPRE.SV40 Biosensor Loren Looger AV-5-PV3107...Douglas Kim AV-9-PV2914 98930-AAV9 pENN.AAV.GFAP.iGluSnFr.WPRE.SV40 Biosensor Loren Looger AV-9-PV3081... Philip Haydon AV-5-PV2407 105549-AAV5 pAAV.GFAP.eGFP.WPRE.hGH Control James M. Wilson AV-5-PV3106 44332...James M. Wilson AV-5-PV2408 105550-AAV5 pAAV.GFAP.Cre.WPRE.hGH Cre Recombinase James M. Wilson AV-6-PV1090...
Showing: 1 - 19 of 19 results