Skip to main content
Addgene

We narrowed to 7 results for: HSP70

Showing: 1 - 7 of 7 results
  1. Plasmids 101: Inducible Promoters

    Type
    Blog Post
    ...exposure. Examples include the heat shock-inducible Hsp70 or Hsp90-derived promoters, in which a gene of choice... exposure to a brief heat shock. In the case of Hsp70, the heat shock releases heat shock factor 1 (HSF...
  2. Of Myc and Men

    Type
    Blog Post
    ...2075.1984.tb02263.x  Munro S, Pelham HRB (1986) An hsp70-like protein in the ER: Identity with the 78 kd ...
  3. Cre-lox system

    Type
    Collection
    ...30524 pCSHSP:Cre heat shock inducible Cre Xenopus hsp70 Xenopus Ryffel 30525 pBSHSP:Cre;CMV:tdTomato-SceI...tdTomato-SceI Cre and tdTomato coexpression Xenopus hsp70 Xenopus Ryffel 31132 pCSCre Cre CMV Xenopus Ryffel 31309... recombinases that are less toxic in Drosophila hsp70 Insect Rubin 32606 Ttr:Cre Cre expressed in visceral...control Gal1 Yeast Gartenberg 50797 pUAS-Cre Cre UAS/Hsp70 Mammalian Cepko 50935 MSCV-PIG-Cre Cre and GFP coexpression...alpha Lentiviral Jacks 60877 pMAZe Cre and dtomato hsp70 Zebrafish Lewis 60930 pPL5071_TEF1*-Cre_URA3 Cre...See article for more colors. Mammalian Zeng 24334 hsp70l-loxP-mCherry-STOP-loxP-H2B-GFP_cryaa-cerulean Heat-inducible...
  4. Sequencing Primers

    Type
    Guide
    ...primer pCasper-hs GCAACTACTGAAATCTGCCAAG Drosophila Hsp70 promoter, forward primer pcDL-F GTTGCCTTTACTTCTAGGCCT...
  5. Immunology Research Plasmids and Resources

    Type
    Collection
    ...FLJ54328, HSP70-1B, HSP70-2, HSPA1A HSPA1L heat shock 70kDa protein 1-like HSP70-1L, HSP70-HOM, HSP70T, hum70t...protein 2 HSP70-2, HSP70-3 HSPA4 heat shock 70kDa protein 4 APG-2, HS24/P52, MGC131852, RY, hsp70, hsp70RY...FLJ54370, FLJ54392, FLJ54408, FLJ75127, HSP70-1, HSP70-1A, HSP70I, HSP72, HSPA1, HSPA1B HSPA1B heat shock..., GRP78, MIF2 HSPA6 heat shock 70kDa protein 6 (HSP70B') - HSPA8 heat shock 70kDa protein 8 HSC54, HSC70...
  6. CRISPR References and Information

    Type
    Collection
    ...and cloning; injection protocol pU6-BbsI-chiRNA ; phsp70-Cas9 PDF, 109 KB Orkin and Bauer Protocol for Genomic...
Showing: 1 - 7 of 7 results