We narrowed to 5 results for: ORF1;
-
TypeBlog Post...amplification kit. In this case, regions of gene S and Orf1ab gene are amplified. RPA reactions also contain ...
-
Validated gRNA Sequences
TypeCollection...Sabatini C3orf17 H. sapiens GGGCCAAATGGGGTTTGTGG 70653 cut S. pyogenes 26472758 Sabatini C3orf17 H. sapiens...Sabatini C9orf114 H. sapiens CAGGCGGGCTCACCTCCGTG 70654 cut S. pyogenes 26472758 Sabatini C9orf114 H. sapiens... -
Immunology Research Plasmids and Resources
TypeCollection...channel, subfamily C, member 4 associated protein C20orf188, TRRP4AP, TRUSS UBR1 ubiquitin protein ligase ... and short cytoplasmic domain, (semaphorin) 4D C9orf164, CD100, FLJ33485, FLJ34282, FLJ39737, FLJ46484...containing 8 SMAP, SMAP2, p120 BTC betacellulin - C19orf10 chromosome 19 open reading frame 10 EUROIMAGE1875335...family with sequence similarity 3, member B 2-21, C21orf11, C21orf76, ORF9, PANDER, PRED44 FAM3C family with...IL1RAP interleukin 1 receptor accessory protein C3orf13, FLJ37788, IL-1RAcP, IL1R3 IL1RL1 interleukin 1...transforming growth factor beta binding protein 2 C14orf141, LTBP3, MSTP031 LTBP3 latent transforming growth... -
Neurodegeneration Plasmid Collection
TypeCollection...ataxia Feng Zhang 142874 TFORF1856 NR4A2 E1Fa Parkinson's Feng Zhang 142875 TFORF1857 NR4A2 E1Fa Parkinson's... IE Feng Zhang 143542 TFORF1771 TBP E1Fa Parkinson's Feng Zhang 143543 TFORF1772 TBP E1Fa Parkinson's ... -
TALENs for Endogenous Zebrafish Genes
TypeCollection...TGGAGAAACAGAAGATGAaatccccgagtccggaGCTGTCTTCACTTTTGGA retinitis pigmentosa GTPase regulator b ORF15 TAL3530 & TAL3531 TAAGAGGGCGGAGCTTTTatctcgcaaagctctgCCCACTGAGTTACTTAGA...