We narrowed to 13 results for: RP1
-
TypeCollection...MAPK13 RP1-179N16.4, MAPK 13, MAPK-13, PRKM13, SAPK4, p38delta MAPK14 RP1-179N16.5...
-
Plasmids 101: Yeast Vectors
TypeBlog Post...required. yes TRP1 L-tryptophan yes - Grow with 5-FAA. S. cerevisiae no no TRP1 alters some yeast... -
28 Hot Plasmid Technologies from 2015
TypeBlog Post...Compartment GFP-Rab4B Mitochondria mito-BFP mCherry-Drp1 (GTPase in division) GFP-Mff (outer membrane protein... -
Immunology Research Plasmids and Resources
TypeCollection...FIL1, FIL1(ZETA), FIL1Z, IL-1F7, IL-1H4, IL-1RP1, IL1H4, IL1RP1 IL1F8 interleukin 1 family, member 8 (eta...FIL1, FIL1(ZETA), FIL1Z, IL-1F7, IL-1H4, IL-1RP1, IL1H4, IL1RP1, IL37 IL1F8 interleukin 1 family, member ...IFI KIAA0368 KIAA0368 ECM29, FLJ22036, KIAA1962, RP11-386D8.2 KIR2DL1 killer cell immunoglobulin-like ...MGC138183 ANGPTL1 angiopoietin-like 1 ANG3, ANGPT3, ARP1, AngY, KIAA0351, UNQ162, dJ595C2.2 ANGPTL2 angiopoietin-like...-related polypeptide alpha CALC1, CGRP, CGRP-I, CGRP1, CT, KC, MGC126648 CALCB calcitonin-related polypeptide...transducer 1) AF-1, IFGR2, IFNGT1 IFNK interferon, kappa RP11-27J8.1 IFNW1 interferon, omega 1 - IGF1 insulin-...33 C9orf26, DKFZp586H0523, DVS27, NF-HEV, NFEHEV, RP11-575C20.2 IL34 interleukin 34 C16orf77, IL-34, MGC34647... -
CRISPR Plasmids - Tagging
TypeCollection...TGIF2_1 PX458_TGIF2_2 SSRP1 Human FLAG pFETCh_SSRP1 PX458_SSRP1_1 PX458_SSRP1_2 ZNF146 Human FLAG pFETCh_ZNF146... -
Arf GTPase Family
TypeCollection... 197 Bacterial (pET), Mammalian (pcDNA3) GTPase Arfrp1 10139 201 Bacterial (pET), Mammalian (pcDNA3), ... Mammalian (pEGFP-C1), Gateway GEF Cyth3 (ARNO3, GRP1) 9265 399 Gateway GEF Cyth4 27128 394 Gateway GEF... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...Resources collection page Yeast GAL4, PGK, ADH1, ADE2, TRP1 Gateway destination vectors - Inducible...cerevisiae plasmids for multiple marker selection TRP1 Yeast pGBKCg - Gateway compatible Y2H vector LEU2... -
Neurodegeneration Plasmid Collection
TypeCollection...'s James Nowick 127192 RP1B FUS 1-163 FUS His T7 ALS Nicolas Fawzi 127193 RP1B FUS 1-163 S12xQ FUS His...Nicolas Fawzi 127194 RP1B FUS 1-163 QQ4xSS #1 FUS His T7 ALS Nicolas Fawzi 127195 RP1B FUS 1-163 QQ4xSS #2...22106 pWJPrP5 PRNP Dementia Susan Lindquist 22109 pWJPrP1 PRNP Dementia Susan Lindquist 22291 pcDNA3-FLAG-Synaptojanin... -
Zinc Finger Consortium: Zinc Finger Arrays
TypeCollection... cCGCTTCAGCggtctGTGGACTCGa zebrafish similar to grp151 (or gpcr-2037) OZ535 and OZ536 OPEN OPEN aGCCATCATCaggttcaGGATGAGCCc... -
Ras Pathway
TypeCollection...specific guanine nucleotide releasing factor RASGRP RASGRP1 RASGRP2 RASGRP3 RASGRP4 RAS guanyl releasing protein... -
TALENs for Endogenous Zebrafish Genes
TypeCollection...TTATCATTCGCATCTCGTatttctctttatattaTTTTATTCCGAGACCCCA prp19 TAL3518 & TAL3519 TTCCAGTTTCAAACGAAGtgccggagcacccctgTGTGTCCCCTGTTTCCAA... -
Validated gRNA Sequences
TypeCollection...GTACGTTCTCTATCACTGATA 62325 scaffold S. pyogenes 25533786 Qi & Lim trp1 S. cerevisiae GTCAATTGTTCTCTTTCTAT 64331 cut S. ... -
Fluorescent Protein Guide: Biosensors
TypeCollection...mitochondrial sensor for H 2 O 2 oxidation (roGFP2-Orp1) Multiplexed Optical Sensors in Arrayed Islands ...