We narrowed to 10 results for: Sp1
-
TypeBlog Post...all SARS-CoV-2 viral proteins except for Nsp3 and Nsp16, and includes an additional catalytically dead version...spec for two of the remaining viral proteins. Only Nsp11 ran bigger than expected, and Orf7b gave a lot of...
-
Allen Institute for Brain Science AAV Enhancer Collection
TypeCollection...FlpO Lamp5 interneurons Isocortex 223971 pAAV-3xSP10ins-AiE0354m-minRho-SYFP2-WPRE3-BGHpA AiP12040 AiE0354m...AiE0219h Cre Vip interneurons Isocortex 208401 pAAV-3xSP10ins-AiE0354h-minRho-SYFP2-WPRE3-BGHpA AiP12039 AiE0354h...tubercle and Fundus of striatum Striatum 191717 pAAV-3xSP10ins-AiE0367h_C2-minRho-SYFP2-WPRE3-BGHpA AiP12514 ... -
Nuclear Receptor Signaling Atlas (NURSA) Plasmid Guide: Nuclear Receptors
TypeCollection...AR plasmids AR, RP11-383C12.1, AIS, DHTR, HUMARA,HYSP1, KD, NR3C4, SBMA, SMAX1, TFM androgen receptor ESR2... -
p53 Pathway
TypeCollection...ubiquitin protein ligase 1 TSC2 Tuberous sclerosis 2 TSP1 Thrombospondin 1 Return to top References Unravelling... -
Ras Pathway
TypeCollection...kinase suppressor of Ras CYTH2 Cytohesin 2 DUSP DUSP1 DUSP2 DUSP3 DUSP4 DUSP5 DUSP6 Dual specificity phosphatase... -
Validated gRNA Sequences
TypeCollection...GAGTAAAAAATTGTACTTGG 64330 cut S. pyogenes 25281382 Jin USP13 H. sapiens GCCGCCCGGCATGCCGAACA 61812 cut S. pyogenes... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...pMCS-rybozyme-IRES-CAS9 64668 Mammalian yes, cut S. pyogenes W Fujii MSP1673 65769 Bacteria T7 yes, cut N. meningitidis Joung... -
Immunology Research Plasmids and Resources
TypeCollection...THBS1 thrombospondin 1 THBS, THBS-1, TSP, TSP-1, TSP1 TRPC4AP transient receptor potential cation channel...MGC45246 AR androgen receptor AIS, DHTR, HUMARA, HYSP1, KD, NR3C4, SBMA, SMAX1, TFM AREG amphiregulin AR... -
CRISPR Guide
TypeCollection...viruses (AAVs) . Other natural Cas orthologs include Hsp1Cas9 (from Helicobacter sp. MIT 11-5569 ) and Nme2Cas9... -
CRISPR Guide
TypeGuide...viruses (AAVs) . Other natural Cas orthologs include Hsp1Cas9 (from Helicobacter sp. MIT 11-5569 ) and Nme2Cas9...