Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 5 results for: VEGF

Showing: 1 - 5 of 5 results

  1. Cancer and the Immune System: Deciphering the Relationship

    Type
    Blog Post
    ...Over-production of vascular endothelial growth factors (VEGF) in tumors is attributed to a signaling cascade,...factor (HIF-1), which promotes the production of VEGF to increase angiogenesis around the tumor. This ...monoclonal antibodies targeting the PD-L1 pathway, VEGF production, and CTLA4 and CD protein blocking. Other...

  2. Validated gRNA Sequences

    Type
    Collection
    ...24424410 Ye VEGF H. sapiens GACCCCCTCCACCCCGCCTC 47506 cut S. pyogenes 23792628 Joung VEGF H. sapiens ...GGGTGGGGGGAGTTTGCTCC 47505 cut S. pyogenes 23792628 Joung VEGF H. sapiens GGTGAGTGAGTGTGTGCGTG 47507 cut S. pyogenes...

  4. Immunology Research Plasmids and Resources

    Type
    Collection
    ...receptor NR1I1 VEGFA vascular endothelial growth factor A MGC70609, MVCD1, VEGF, VEGF-A, VPF VEGFB vascular ...factor (vascular endothelial growth factor D) VEGF-D, VEGFD FIGNL2 fidgetin-like 2 - FLT1 fms-related tyrosine... III receptor tyrosine kinase) CD309, FLK1, VEGFR, VEGFR2 KGFLP1 keratinocyte growth factor-like protein...DKFZp781F1414, NP1, NRP, VEGF165R NRP2 neuropilin 2 MGC126574, NP2, NPN2, PRO2714, VEGF165R2 NRTN neurturin NTN...vascular endothelial growth factor B VEGFL, VRF VEGFC vascular endothelial growth factor C Flt4-L, VRP VGF VGF...factor/vascular permeability factor receptor) FLT, VEGFR1 FLT3 fms-related tyrosine kinase 3 CD135, FLK2,...fms-related tyrosine kinase 4 FLT41, LMPH1A, PCL, VEGFR3 FPR1 formyl peptide receptor 1 FMLP, FPR FPR2 formyl...

  5. TALENs for Endogenous Zebrafish Genes

    Type
    Collection
    ...TGACTGGGAGGAAGATCAgagtcccgttgtgtctTGCAGCTCAGGATTTGGA Vascular-endothelial growth-factor-aa (vegfaa) TAL3200 & TAL3201 TCTCGCTTTGCTTCCTCCtcagtgattcccttcaTGGATGTGTATAAAAAGA...
Showing: 1 - 5 of 5 results