...polarization independent of GDI-mediated extraction and actin-based trafficking." PLoS biology 13.4 (2015): e1002097...

...different cells. Promoters such as chicken-beta-actin or CAG can drive strong early gene expression, but...

...have been transfected with a plasmid encoding GFP. Actin, a common internal control for Western blots, shows...

...AC5 ACACAAAGCCGCTCCATCAG (Invitrogen) Drosophila Actin 5C promoter, forward primer Alpha-factor TACTATTGCCAGCATTGCTGC...

...as mitochondria, as well as macromolecules like actin and myosin, and enzymes for transmitter synthesis...

...Cre CMV Xenopus Ryffel 31309 pCARCre Cre cardiac actin Xenopus Ryffel 32144 pJFRC170-3XUAS-IVS-Cre::PEST...

...from a Drosophila U6:2 promoter and Cas9 from the actin 5C promoter. Addgene’s fly library web page offers...

... as well as the identification of additional interacting factors. Problems with Existing Methods for ... the identification of weak and/or transient interacting proteins. No spatiotemporal control. Many PPI...particular point in time, i.e. when the bait is interacting with a particular protein partner or when the...is its spatiotemporal controlled labeling of interacting proteins; nearby proteins are biotinylated when...labeling ceases when these two bait proteins stop interacting. This feature is particularly useful for in-depth...tetracycline induced expression and biotinylation of interacting proteins. This extended incubation period could...ligase fusion protein identifies proximal and interacting proteins in mammalian cells. The Journal of cell...

...hsp70: mKate2 dynactin1-811 DCTN1 mKate2 hsp70 ALS Caren Norden 105971 pME mKate2-dynactin1-811 DCTN1 mKate2...115182 pLD-puro-Cc-PARK7WT-VA PARK7 His, Flag, Streptactin CMV Parkinson's Mohan Babu 115183 pLD-puro-Cc-PARK7V51G-VA...pLD-puro-Cc-PARK7V51G-VA PARK7 His, Flag, Streptactin CMV Parkinson's Mohan Babu 115184 pLD-puro-Cc-PARK7C53A-VA...-VA PARK7 His, Flag, Streptactin CMV Parkinson's Mohan Babu 115185 pLD-puro-Cc-PARK7H126A-VA PARK7 His...His, Flag, Streptactin CMV Parkinson's Mohan Babu 115186 pLD-puro-Cc-PARK7E163K-VA PARK7 His, Flag, Streptactin...115187 pLD-puro-Cc-CR-PARK7WT-VA PARK7 His, Flag, Streptactin CMV Parkinson's Mohan Babu 115188 pLD-puro-Cc-CR-PARK7V51G-VA...pLD-puro-Cc-CR-PARK7V51G-VA PARK7 His, Flag, Streptactin CMV Parkinson's Mohan Babu 115189 pLD-puro-Cc-CR-PARK7C53A-VA...

...protein-protein interaction as well as identify additional interacting proteins in one simple experiment. PCA is an ...reassemble to restore activity when fused to two interacting proteins (Schopp et al., 2016). Thus in one experiment...surface of a cell of interest, where it can label interacting cell surface proteins with a biotin tagged LPETG...ligase fusion protein identifies proximal and interacting proteins in mammalian cells." J Cell Biol 196.6...

... pair on actinin will produce different signals based on changes to the structure of actinin in low vs...associated with specific proteins of interest such as actinin. When tension is high vs. low in the cell the donor...

...biology-related customer support interaction. Before contacting customer service In an age of Tweeting and texting...customer service experience: Make sure you’re contacting the correct company. This might seem like a no-brainer...responses. No one is likely to look forward to contacting customer service, but the experience should never...

...sequences at its 3’ and 5’ ends that are crucial cis-acting signals for genome replication and viral gene transcription...sequences. Thus, the minigenome contains all cis-acting signals necessary to direct minigenome replication...) can be studied by changing the minigenome cis-acting sequences and monitoring effects on genome replication...

...polypeptide PNP PRL prolactin - PRLH prolactin releasing hormone PRH, PRRP PRLHR prolactin releasing hormone..., CXC3, CXC3C, NTN, NTT, SCYD1, fractalkine, neurotactin CX3CR1 chemokine (C-X3-C motif) receptor 1 CCRL1... GPR10, GR3, MGC126539, MGC126541, PrRPR PRLR prolactin receptor hPRLrI PROK1 prokineticin 1 EGVEGF, PK1...oncogene homolog A-RAF, ARAF1, PKS2, RAFA1 BID BH3 interacting domain death agonist FP497, MGC15319, MGC42355...

...of support and structure, prevent science from attracting and keeping diverse talent in science related...prioritize ongoing work.  If we’re going to continue attracting and launching science talent we must ensure that...

...it, wrote these tips for working with RNA and extracting RNA without a kit. 3. SARS-CoV-2/COVID-19 Detection...Kit blog post, we've compiled five methods for extracting DNA without a kit too. 1. Early Career Researcher...

...outreach and community engagement. Information about contacting Addgene can be found on our Contact page. You...sharing those ideas with others. This love of interacting with people and talking about science makes her...

...stationary phase, Segall-Shapiro et al. placed a trans-acting RepA protein under the control of IPTG. Because... from a plasmid to the genome without greatly impacting the level of gene expression. For example, the...

...their target protein and an E3 ligase through interacting ligands. After an E3 ligase facilitates ubiquitination..., given the diversity of protein structures, interacting partners, and localization. Thankfully, this ...

...can tell you things like which enhancers are interacting with which promoters, what part of a gene enhancers...how many promoters or genes each enhancer is interacting with. Super enhancers are particularly good models...