We narrowed to 3 results for: actin
-
TypeGuide...AC5 ACACAAAGCCGCTCCATCAG (Invitrogen) Drosophila Actin 5C promoter, forward primer Alpha-factor TACTATTGCCAGCATTGCTGC...
-
Optogenetics Guide
TypeGuide...been created and identified in other species - by acting as light-gated chloride channels, these variants...740–780 Phy–PIF Light-controlled Phytochrome Interacting Factor 6 (PIF6) to PhyB (Phy) interaction 660...DNA-binding domain with cryptochrome 2 protein and its interacting partner CIB1 to control transcription effectors... -
CRISPR Guide
TypeGuide...or by fusing the gRNAs to orthogonal protein-interacting RNA aptamers, such as in the CRISPRainbow kit...