We narrowed to 4 results for: actin

...Constitutive Insect Strong promoter from Drosophila actin 5c gene Gal4/UAS Specific Insect Requires UAS regulatory...CMV early enhancer element and the chicken beta-actin promoter CMV Constitutive Mammalian Strong promoter...

...promoter Forward AC5 ACACAAAGCCGCTCCATCAG Drosophila Actin 5C promoer Forward Alpha-factor TACTATTGCCAGCATTGCTGC...

...been created and identified in other species. By acting as light-gated chloride channels, these variants...cryptochrome Cry2 and its binding partner cryptochrome-interacting basic helix-loop-helix CIB1. Blue light induces...Light-controlled, reversible dimerization of Phytochrome Interacting Factor 3 or 6 (PIF3 or PIF6) with PhyB 660 PhyA...localization or conformation (or that of its interacting partner). Color of Illumination Light Different...

...or by fusing the gRNAs to orthogonal protein-interacting RNA aptamers, such as in the CRISPRainbow kit...