We narrowed to 4 results for: actin
-
TypeGuide...Constitutive Insect Strong promoter from Drosophila actin 5c gene Gal4/UAS Specific Insect Requires UAS regulatory...CMV early enhancer element and the chicken beta-actin promoter CMV Constitutive Mammalian Strong promoter...
-
Sequencing Primers
TypeGuide...promoter Forward AC5 ACACAAAGCCGCTCCATCAG Drosophila Actin 5C promoer Forward Alpha-factor TACTATTGCCAGCATTGCTGC... -
Optogenetics Guide
TypeGuide...been created and identified in other species. By acting as light-gated chloride channels, these variants...740–780 Phy–PIF Light-controlled Phytochrome Interacting Factor 6 (PIF6) to PhyB (Phy) interaction 660...DNA-binding domain with cryptochrome 2 protein and its interacting partner CIB1 to control transcription effectors... -
CRISPR Guide
TypeGuide...or by fusing the gRNAs to orthogonal protein-interacting RNA aptamers, such as in the CRISPRainbow kit...