...AC5 ACACAAAGCCGCTCCATCAG (Invitrogen) Drosophila Actin 5C promoter, forward primer Alpha-factor TACTATTGCCAGCATTGCTGC...

...been created and identified in other species - by acting as light-gated chloride channels, these variants...740–780 Phy–PIF Light-controlled Phytochrome Interacting Factor 6 (PIF6) to PhyB (Phy) interaction 660...DNA-binding domain with cryptochrome 2 protein and its interacting partner CIB1 to control transcription effectors...

...7 mutations found in the REC2, REC3, and PAM interacting domains and allows for expanded PAM recognition...Alternatively, gRNAs can be fused to protein-interacting RNA aptamers, which recruit specific RNA-binding...method uses gRNAs fused to orthogonal protein-interacting RNA aptamers, which recruit specific orthogonal...