Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 61 - 80 of 80 results

  5. Plasmids 101: Biotinylation

    Type
    Blog Post
    ...Buoyancy-Activated Cell Sorting Using Targeted Biotinylated Albumin Microbubbles.” PLoS ONE 10.5 (2015). PubMed PMID...

  6. Site Directed Mutagenesis by PCR

    Type
    Blog Post
    ...potentially introduced anywhere in the plasmid (albeit at extremely low frequency), and these could interfere...

  17. Validated gRNA Sequences

    Type
    Collection
    ...GGACTGGAGGACTTCTGGGG 64250 cut S. pyogenes 25855067 Chen Tyr (albino) R. norvegicus TTTCCAGGATTATGTAATAG 60966 cut S...

  18. Using AAV for Neuronal Tracing

    Type
    Blog Post
    ...are used. For predominantly retrograde tracing, albumin protein labelled with horseradish peroxidase (HRP...

  19. 27 Hot Plasmids from 2016

    Type
    Blog Post
    .... Parton DL, Hanson SM, Rodríguez-Laureano L, Albanese SK, Gradia S, Jeans C, Seeliger MA, Levinson NM...
Showing: 61 - 80 of 80 results