Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 4 of 4 results

  1. Using CRISPR/Cas9 to Edit Disease Out of the Genome

    Type
    Blog Post
    ...cystic fibrosis transmembrane conductor receptor (CFTR) by homologous recombination in cultured intestinal.... 8. Gerald Schwank et al. "Functional Repair of CFTR by CRISPR/Cas9 in Intestinal Stem Cell Organoids...

  2. CRISPR in the Clinic

    Type
    Blog Post
    ...2013). Gerald Schwank et al. "Functional Repair of CFTR by CRISPR/Cas9 in Intestinal Stem Cell Organoids...

  4. Validated gRNA Sequences

    Type
    Collection
    ...GGCAACGTTTGACTTCCTGA 50718 cut S. pyogenes 24284873 Ikawa CFTR H. sapiens TCTGTATCTATATTCATCAT 58783 cut S. pyogenes...
Showing: 1 - 4 of 4 results