Skip to main content
Addgene

We narrowed to 4 results for: cftr

Showing: 1 - 4 of 4 results
  1. Using CRISPR/Cas9 to Edit Disease Out of the Genome

    Type
    Blog Post
    ...cystic fibrosis transmembrane conductor receptor (CFTR) by homologous recombination in cultured intestinal.... 8. Gerald Schwank et al. "Functional Repair of CFTR by CRISPR/Cas9 in Intestinal Stem Cell Organoids...
  2. CRISPR in the Clinic

    Type
    Blog Post
    ...2013). Gerald Schwank et al. "Functional Repair of CFTR by CRISPR/Cas9 in Intestinal Stem Cell Organoids...
  3. Validated gRNA Sequences

    Type
    Collection
    ...GGCAACGTTTGACTTCCTGA 50718 cut S. pyogenes 24284873 Ikawa CFTR H. sapiens TCTGTATCTATATTCATCAT 58783 cut S. pyogenes...
Showing: 1 - 4 of 4 results