...TARDBP GAL ALS Aaron Gitler 27465 pDuet TDP-43 Q331K TARDBP GAL ALS Aaron Gitler 27466 pRS426 Gal TDP43...TDP43 TARDBP GAL ALS Aaron Gitler 27467 pRS426 Gal TDP43 GFP TARDBP GFP GAL ALS Aaron Gitler 27468 pRS303...Fawzi 127194 RP1B FUS 1-163 QQ4xSS #1 FUS His T7 ALS Nicolas Fawzi 127195 RP1B FUS 1-163 QQ4xSS #2 FUS His... type 1 scFv [L24/1] ITPR1 CMV Spinocerebellar ataxia James Trimmer 206790 IP3 receptor, type 1 scFv [...1185 p416 25Q GAL HTT GFP GAL1 Huntington's Susan Lindquist 1186 p416 103Q GAL HTT GFP GAL1 Huntington's...1187 p426 25Q GAL HTT GFP GAL1 Huntington's Susan Lindquist 1188 p426 103Q GAL HTT GFP GAL1 Huntington's...27458 pRS416 Gal TDP43 WT TARDBP GAL1 ALS Aaron Gitler 27459 pRS416 Gal TDP43 G294A TARDBP GAL1 ALS Aaron...

...containing T7 RNAP (DE3) F- ompT lon hsdSB (rB- mB-) gal dcm (DE3) General protein expression BL21 (DE3...origin of replication F- ompT lon hsdSB (rB- mB-) gal dcm (DE3) pLysS (CamR) Expression of toxic proteins...origin of replication F- ompT lon hsdSB (rB- mB-) gal dcm (DE3) pLysE (CamR) Expression of toxic proteins...transcript half-life F- ompT lon hsdSB (rB- mB-) gal dcm rne131 (DE3) General expression; not recommended...required for expression F- ompT lon hsdSB (rB- mB-) gal dcm araB::T7RNAP-tetA General protein expression...repetative sequences.  F- ompT lon hsdSB (rB- mB-) gal dcm (DE3) Δ(srl-recA)306::Tn10 (TetR) Expression...control of expression F- ompT lon hsdSB (rB- mB-) gal dcm lacY1 (DE3) Expression of toxic or insoluble...

...from yeast (1). It is a Drosophila geneticist’s main workhorse to turn genes on or off. Gal4 is a transcriptional.... B. Duffy, GAL4 System in Drosophila : A Fly Geneticist’s Swiss Army Knife, Genesis 34, 1–15 (2002).PubMed...H. Brand, The GAL4 System : A Versatile Toolkit for Gene Expression in Drosophila, 3, 1–10 (2015). PubMed...he still reads “#” as a “pound symbol”. References 1. A. H. Brand, N. Perrimon, Targeted gene expression...-type specificity! The Gal4/UAS system At a more detailed level, the Gal4/UAS system is a transcription...the UAS sequence are only expressed when Gal4 is expressed. Gal4 expression can be regulated by any chosen...Controlling multiple genes with Gal4/UAS system One can also use Gal4 to drive expression of multiple ...

...Vogelstein 16407 pAdEasy 2-GFP beta-gal Shuttle Test plasmid that contains β-gal and GFP; contains ∼10Kb genomic...plasmid Vogelstein 16399 AdEasier-1 BJ5183 derivative that contains AdEasy-1™ plasmid Vogelstein Adenoviral...inserts. ID Plasmid Type Description PI 16400 pAdEasy-1 Adenoviral For recombining shuttle plasmids Vogelstein...for the AdenoBuilder genome assembly system. Block 1 with deletion in E1 and insertion of GFP expression...

...expressed, the β-galactosidase enzyme can break down a dye-linked substrate called x-gal (5-bromo-4-chloro.... On the other hand, intact β-galactosidase produces pigment from x-gal (included in the transformation...enough time for any intact β-galactosidase to be expressed and process x-gal into blue pigment (16-20 hours... lactose analogue, IPTG (isopropyl β-D-1-thiogalactopyranoside). (To be completely accurate, IPTG binds... should be blue, indicating that your IPTG and x-gal are working as they should be. Don't rush the process...white colonies. Take care in making your plates: X-gal is light and temperature sensitive and needs to be...chloro-3-indolyl-β-D-galacto-pyranoside) into galactose and an insoluble blue pigment (4-chloro-3-brom-indigo...

...researcher, when the substrate X-gal is broken down by 𝛽-galactosidase, it turns into an insoluble blue...disrupting 𝛽-galactosidase activity. These cells, presumably the cell you want, cannot break down X-gal and are...transformation on ampicillin plates containing X-gal allows you to identify cells that took up the vector...screening blog post for more information.   Figure 1: Result of a blue-white screen. Image from Stefan ...Because Sanger sequencing can usually sequence just 1 kb of DNA, custom primers are especially helpful in...on the lacZ gene. lacZ encodes the enzyme 𝛽-galactosidase which can hydrolyse lactose. Fortunately, for... is deleted, it creates a non-functional 𝛽-galactosidase. Complementing this mutation by expressing this...

...featuring a guest blog post from Gal Haimovich of greenfluorescentblog. Gal will share his list of 10 things...experiments. In the meantime, if you haven't checked out Gal's blog, you should! He's got great articles and insight...fluorophores are constantly being engineered. Table 1 below lists a few common fluorescent proteins and ...definitions found in Table 2 may not apply. Table 1: The specific mutations comprising common fluorophores...

...  Plasmids for cGAL and split cGAL systems The Sternberg lab in 2016 created cGAL, a GAL-4 based bipartite... MicroPublication 1 (2018): 2–3. Wang, Han, et al. "cGAL, a temperature-robust GAL4–UAS system for Caenorhabditis...this system a promoter controls the expression of a GAL-4 driver that can bind to activation sequences upstream...expanded on this tool by splitting cGAL4 in two and binding each half to a gp41-1-N-intein. Split inteins are...Zhang et al., 2015). In this system a modified TIR-1 protein can degrade degron-tagged proteins in an auxin...split system, only cells that have both halves of cGAL can drive expression of your gene of interest.  ...Central PMCID: PMC5693259.  Wang, Han, et al. "Split cGAL, an intersectional strategy using a split intein...

...This post was contributed by Gal Haimovich of greenfluorescentblog. Be honest. Do you really know how...greenfluorescentblog. Thank You to Our Guest Blogger! Gal Haimovich, PhD, is a research fellow in the lab of...biological questions. The two most common uses are: 1) to test the expression level in a specific system...brightness is compared to that of EGFP which is set as 1. Some proteins are very dim (e.g. TagRFP657, which...Photostability can be as short as 100ms (EBFP) or as long as 1 hour (mAmetrine1.2). However, for most FPs it is a...

...' mcrA Δ(mcrBC-hsdRMS-mrr) recA1 endA1 gyrA96 gal-thi-1 supE44 λ-relA1 Δ(lac-proAB)/F' proAB+lacIqZΔM15...Table 1 below outlines a few of the more common genetic changes found in E. coli strains. Table 1: Common...resistance gal Mutation in galactose metabolism pathway Cells cannot grow on galactose only gyrA, ...(rB- mB-) recA13 leuB6 ara-14 proA2 lacY1 galK2 xyl-5 mtl-1 rpsL20(SmR) glnV44 λ- JM109   General cloning...mcrB mrr hsdS20(rB-, mB-) ara-14 galK2 lacY1 proA2 rpsL20 xyl-5 leu mtl-1 Stbl4   Electrocompetent cells...amber (UAG) stop codon by tyrosine insertion λ-thi-1 or thi1 Mutation in thiamine metabolism Requires exogenous... all based on E. coli K-12 and are considered BSL-1. Table 2: Lab strains of E. coli Strain Natural...

... assembly reaction** 1 5 min., 37 ºC (2.5 μl) 687 100% 274,200 2,742,000 1 60 min., 37 ºC (2.5 μl)... a blue colony phenotype upon growth on LB/Cam/X-gal/IPTG agar plates, indicating successful reconstruction...expected complete sequence for the lacI/lacZ genes (1), while sequencing of white colonies showed a mixture...representative transformation plates obtained from 1-, 12- and 24-fragment assemblies of the lacI/lacZ ...lacZ cassette, and illustrates how the volume of the 1 ml outgrowth spread on each transformation plate can...fidelity studies conducted by Potapov et al. at NEB (1, 2). While T4 DNA Ligase, the mainstay of most biotechnological...over 90% for 24-fragment assemblies (Figure 3, Table 1). These improvements (5- to 12-fold increases in the...

...HIV-1 were transduced with a lentiviral vector containing an antisense sequence against the HIV-1 envelope... et al. transduced rat neurons in vivo with beta-gal and other reporters, and they showed that expression...Trono and collaborators turned to the lentivirus HIV-1, well-known to infect non-dividing cells. The first...plasmids. The packaging plasmid carried a mutated HIV-1 provirus that couldn’t package itself due to a few...plasmid encoded the desired transgene flanked by HIV-1 long terminal repeats (LTRs) that facilitate viral... targeting and tracing cells in the brain (Figure 1). 2nd generation lentiviral packaging system The graphic...infectivity, is often used as a substitute for HIV-1 Env, which can only infect CD4+ cells. 3rd generation...

...attract fish for them to prey upon (Figure 1). Figure 1: The sea anemone's red color can be used ...techniques such as  blue-white screening require X-gal, an expensive exogenously-added substrate, chromoproteins...synthetic biology. Journal of Biological Engineering, 12(1). https://doi.org/10.1186/s13036-018-0100-0 Murakoshi...expression in living cells. Scientific Reports, 9(1). https://doi.org/10.1038/s41598-019-48604-4 Salih...

...and GAL 80. TEF1 General expression mRNA Yeast transcription elongation factor promoter Constitutive  ...mammalian expression from human elongation factor 1 alpha Constitutive  Tends to give consistent expression...Drosophila promoter conaining Gal4 binding sites Specific Requires the presence of Gal4 gene to activate promoter...with galactose; repressible with glucose  Can be used independently or together. Regulated by GAL4 and ...mammalian expression promoter from the human cytomegalovirus Constitutive  May contain an enhancer region...expression. Modulated by calcium and calmodulin. GAL1, 10 General expression mRNA Yeast adjacent, divergently...

...IGHDY1 IGHD1-1 immunoglobulin heavy diversity 1-1 IGHD11 IGHD1-14 immunoglobulin heavy diversity 1-14 (non-...IGHV6-1 immunoglobulin heavy variable 6-1 IGHV61, VH IGHV7-4-1 immunoglobulin heavy variable 7-4-1 IGHV7... TAPBP-R, TAPBPR THBS1 thrombospondin 1 THBS, THBS-1, TSP, TSP-1, TSP1 TRPC4AP transient receptor potential...variable 2-8 IGLV28, V1-2 IGLV3-1 immunoglobulin lambda variable 3-1 IGLV31, V2-1 IGLV3-10 immunoglobulin lambda...NCC-1, NCC1, SCYA13, SCYL1 CCL14 chemokine (C-C motif) ligand 14 CC-1, CC-3, CKb1, FLJ16015, HCC-1, HCC... 3 G0S19-1, LD78ALPHA, MIP-1-alpha, MIP1A, SCYA3 CCL3L1 chemokine (C-C motif) ligand 3-like 1 464.2, D17S1718...GPD, GpFy, WBCQ1 DEFA1 defensin, alpha 1 DEF1, DEFA2, HNP-1, HP-1, MGC138393, MRS DEFA3 defensin, alpha...

...AdEasier®-1 cells (strain) - Bacterial strain that contains AdEasy®-1 plasmid... - Retroviral gene expression pLKO.1 - TRC cloning vector - Lentiviral... Tet-inducible lentiviral shRNA expression pMKO.1 puro - Retroviral shRNA expression ... - Retroviral gene expression pLKO.1 hygro - Lentiviral shRNA expression... - Retroviral gene expression pMKO.1 GFP - Retroviral shRNA expression pSico... expression, multiple selectable markers pMKO.1 puro - Mammalian retroviral shRNA expression...under your chosen promoter pAdEasy®-1 - Recombine plasmids from the shuttle...

...apparatus eNOS(1-33) CFP Alexandra Newton 36205 pmTurquoise2-Golgi Golgi apparatus B4GALT1(1-61) mTurquoise2...Brown 11908 pEGFP-N1 alpha-actinin 1 Actin Filaments alpha-actinin 1 EGFP Carol Otey 27676 Cortactin-pmCherryC1...Huttenlocher 11908 pEGFP-N1 alpha-actinin 1 Focal Adhesions alpha-actinin 1 EGFP Carol Otey 31923 pPaxillin-PSmOrange...Autophagosome Sequestosome-1 EGFP Noboru Mizushima 38272 pMXs-IP GFP-WIPI-1 Autophagosome WIPI1 EGFP Noboru... Shirihai 158003 pCMV-mGold-CAF1-C-10 Nucleus CAF-1 mGold Francois St-Pierre 27705 CAV1-mCherry Caveolae...COXIV-COX8-dL5-2XG4S-mCer3 Mitochondria COX IV-derived (1-22 aa) import sequence and COX VIII signal peptide...Verkhusha 36208 pmTurquoise2-Mito Mitochondria COX8A(1-29) mTurquoise2 Dorus Gadella 26673 pEGFP-C1-Fibrillarin...

...Cre-GFP fusion EF-1 alpha Mammalian Sauer 11923 pBS598 EF1alpha-EGFPcre Cre-EGFP fusion EF-1 alpha Mammalian...mCherry coexpression EF-1 alpha AAV Deisseroth 55635 pAAV-EF1a-sCre SCre EF-1 alpha AAV Deisseroth 55636...55636 pAAV-EF1a-Cre Cre EF-1 alpha AAV Deisseroth 55638 pAAV-EF1a-vCre VCre EF-1 alpha AAV Deisseroth 59701...) EF-1 alpha AAV Cepko 69571 pAAV-EF1a-C-CreintG Cre recombinase dependent on GFP (CRE-DOG) EF-1 alpha... dual RMCE EF-1 alpha Mammalian Zeller 26850 pBF3038 Cre codon optimized for yeast Gal1 Yeast Sandmeyer... Mammalian Sauer 11918 pBS513 EF1alpha-cre Cre EF-1 alpha Mammalian Sauer 11919 pBS448 RSV-GFPcre Cre-...11955 pBS505 EF1alpha-EGFPcre* Cre-EGFP fusion EF-1 alpha Mammalian Sauer 11956 pBS594 promoterless EGFPcre...

...pCDH-EF1-DIO-copGFP 72253 Expresses copGFP under EF-1 promoter when Cre is expressed by another vector pCDH-EF1...pCDH-EF1-DIO-tdTomato 72254 Expresses tdTomato under EF-1 promoter when Cre is expressed by another vector pCDH-CB-iCre-P2A-tdTomato-T2A-Puro...vector pCDH-EF1-FLPe 72262 Expresses FLPe from the EF-1 promoter pCDH-EF1-copGFP-T2A-Puro 72263 Express copGFP...pCDH-EF1 72266 Express gene of interest from the EF-1 promoter pCDH-CB 72267 Express gene of interest from...72484 Express gene of interest from a truncated EF-1 promoter pCDH-EF1-Luc2-P2A-copGFP 72485 Expresses ...blue-white screening and forms blue colonies on LB/Amp/Xgal/IPTG plates – if your insert is successfully cloned... the CMV promoter, forms blue colonies on LB/Amp/Xgal/IPTG plate pAdx-CMV-copGFP 73346 Expresses copGFP...

...Mendenhall rde-1(D718) C. elegans TGCCATTAACTATGTATGT 59927 cut S. pyogenes 25161212 Fire rde-1(D801) C. elegans...24346702 Wolfe sqt-1 C. elegans GGAAGGACATAGTTGTCAT 59935 cut S. pyogenes 25161212 Fire sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT...AMPK alpha 1 H. sapiens GGCTGTCGCCATCTTTCTCC 74374 nick S. pyogenes 26816379 Shaw AMPK alpha 1 H. sapiens...26355004 Mendenhall csr-1 N. crassa GAGTGGGAGGGTCCCGTCCT 68060 cut S. pyogenes Fungal Biology and Biotechnology...GCATGGGTGATGTCAATGCC 69238 cut S. pyogenes 26480473 Wolfe Kit-1 R. norvegicus CATCTGTGCGGCCGTTGGCT 60969 cut S. pyogenes...TTGATCCAAATTATAACCCG 68896 interfere S. pyogenes 26918244 Lu NDM-1 GGGCAGTCGCTTCCAACGGTTTGATCGTCA 61270 cut S. pyogenes... 60719 activate S. pyogenes 25664691 Gersbach pha-1 C. elegans ATGAATAACTTGATGAACAT 61252 cut S. pyogenes...