...supE44 thi-1 gyrA96 relA1 tonA JM109 Addgene; Promega e14-(McrA-) recA1 endA1 gyrA96 thi-1 hsdR17(rK- ...England BioLabs E. coli B F dcm ompT hsdS(rB mB) gal ccdB Survival Invitrogen F- mcrA Delta(mrr-hsdRMS-mcrBC...mB–) recA13 supE44 ara-14 galK2 lacY1 proA2 rpsL20 (StrR ) xyl-5 λ– leu mtl-1 Top10 Invitrogen F- mcrA ...use, dilute your antibiotic into your LB medium at 1:1,000. For example, to make 100 mL of LB/ampicillin...Delta-lacX74 recA1 araDelta139 D(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG tonA::Ptrc ccdA DB3.1 Invitrogen...(TetR) ∆(ara-leu) 7697 araD139 fhuA ∆lacX74 galK16 galE15 e14- Φ80dlacZ∆M15 recA1 relA1 endA1 nupG rpsL...Delta-lacX74 recA1 araD139 Delta(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG Antibiotics commonly used...

... CMV immediate early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter...end of LexA DNA binding domain, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC...origin, forward primer GAL1 AATATACCTCTATACTTTAACGTC (Invitrogen) S. cerevisiae GAL1 promoter, forward primer...primer Gal10pro-F GGTGGTAATGCCATGTAATATG (Stratagene) S. cerevisiae GAL10 promoter, forward primer Gal4...GAGTAGTAACAAAGGTCAA 3' end of Gal4 DNA binding domain, forward primer Gal4-AD AATACCACTACAATGGAT (BD Biosciences...Biosciences) 3' end of Gal4 activation domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP...

...lentiviral transfer plasmids are based on the HIV-1 virus. For safety reasons, transfer plasmids are all...shRNA‐expressing lentiviral plasmids, such as pLKO.1, use a U6 or H1 promoter in order to drive RNA pol...protocol for using the popular cloning vector pLKO.1. Trono Lab Resources: Lentivectors Toolbox and Maps...selection. Desfarges S, Ciuffi A. Viruses. 2010. Jan;2(1):111-30. PubMed . Altering the tropism of lentiviral...Curr Gene Ther. 2005. 5(4): 387-398. PubMed . HIV-1 Genome Nuclear Import Is Mediated by a Central DNA...cells by a lentiviral vector. Naldini L, Blömer U, Gallay P, Ory D, Mulligan R, Gage FH, Verma IM, and Trono...

...algae Chlamydomonas reinhardtii . Channelrhodopsin-1 (ChR1) is excited by blue light and permits nonspecific...based on the LOV2 domain of Avena sativa phototropin 1 LOVETRAP reversibly sequester and release proteins...concept of optogenetics. 2012 Prog Brain Res. 196: 1-28. PMID 22341318 Gradinaru V, Zhang F, Ramakrishnan...diversifying and extending optogenetics. Cell. 196:1-28. PMID 20303157 Han X, Boyden ES. 2007 Multiple-...Limitations and Future Developments. Exp Physiol. 96(1): 19–25. PMID 20621963 Mattis J, Tye KM, Ferenczi ...both the identification of novel ChRs from other algal species and the development of synthetic variants...

.... Figure 1. DREADDs, their ligands, and signaling properties. Please see the text or table 1 for details...bidirectional control of neuronal activity. Table 1. Descriptions of DREADDs and their activity in neurons...delivery, while PSEMs have an effect for only 0.5-1 hours after delivery. Chemogenetic Ligand. The chemogenetic...Bonaventura J, Zemla R, Gomez JL, Ramirez MH, Hu X, Galvan A, Basu J, Michaelides M, Sternson SM (2019). Ultrapotent...

... your experiment. Libraries may be available in a 1-plasmid system, in which Cas9 is included on the gRNA-containing...sequence for Staphylococcus aureus Cas9 (SaCas9) is ∼1 kb shorter than SpCas9, SaCas9 can be efficiently ...sequences containing a G nucleotide at position 20 (1 bp upstream of the PAM) may be more efficacious than...population. Some cells may be wild type due to either (1) a lack of gRNA and/or Cas9 expression or (2) a lack...Giovannangeli C, Concordet JP. Nat Commun . Mar 19;9(1):1133. PMID: 29556040 Directed evolution of CRISPR-Cas9...Jung I, Kim D, Kim S, Kim JS. Nat Commun . Aug 6;9(1):3048. PMID: 30082838 Engineered anti-CRISPR proteins...DE, Piccioni F, Doench JG. Nat Commun . Dec 21;9(1):5416. PMID: 30575746 Synthetic CRISPR-Cas gene activators...

...human cytomegalovirus EF1a Constituitve Strong mammalian promoter from human elongation factor 1 alpha...expression UAS Specific Drosophila promoter containing Gal4 binding sites Bacterial Promoters Promoters in bacteria...