...easier cloning. Abbreviated protocol for PITCh Step 1: Generate microhomologies in the PITCh vector ~20...editing possibilities MMEJ can enable. References 1. Sakuma, Tatsushi, et al. (2016).  “MMEJ-assisted ...CRISPR-Cas9 with the PITCh systems.” Nat Protoc. 11(1): 118-33. PMID: 26678082. Find the plasmids from ...microhomology-mediated end joining in Aspergillus fumigatus.” Fungal Genet Biol. 86: 47-57. PMID: 26701308. Additional...

...from the fungal photoreceptor, Vivid (VVD, N. crassa) (Kawano et al., 2015). Nicknamed paCas9-1 and consisting...2 (CRY2) and calcium and integrin-binding protein 1 (CIB1) proteins. The goal of both groups was to create... the Sata lab is composed of two fusion proteins: 1) the genomic anchor - an inactive, dead Cas9 protein...combination. The optimized LACE system consisted of: 1) CIBN-dCas9-CIBN, where CIBN is the N-terminal fragment...fold-induction of Cas9 activity (16.4-fold). This paCas9-1 light-inducible system was able to recognize the same...flCas9). When triggered by blue light (470nm), paCas9-1 induced indel mutations via NHEJ (frequency of 20.5%...background activity of the system by modifying paCas9-1 using nMagC714 instead of nMagHigh1-C714, generating...

...a major tool used by Drosophila geneticists (the Gal4/UAS system), and the third post will describe how...

...Molecular and cellular endocrinology 215.1-2 (2004): 1-10. PubMed PMID: 15026169. Soo, Rochelle M., et al...point where the temperature and humidity favors fungal growth. The ants bites down and locks their jaws...its muscles atrophy. After the ant’s death, the fungal fruiting bodies being to sprout out of the ant’...

...with a single insertion because it will segregate 3:1 in the T2 generation. You also have no control over... transgenic plants in the process.     References 1. Emami, S., Yee, M. and Dinneny, J. R. (2013) ‘A robust...transformation’, Plant Methods. BioMed Central, 2(1), p. 19. doi: 10.1186/1746-4811-2-19. PubMed PMID:... as anthocyanin production, or disease, such as fungal growth. Healthy plants produce lots of seeds. More...

...impartial. The best science happens when scientists have 1) the courage to make mistakes and 2) the integrity...of what I saw are that we, as a society, need to: 1) use more citations for out data so our sources are... before.  These attacks on science ultimately galvanized scientists to rally in Ottawa to protest the ...AL, USA 33.5207°N 86.8025°W - Jonathan Aguilar Galileo wrote, “now you would not hide behind these two... large one” (http://oll.libertyfund.org/titles/galilei-dialogues-concerning-two-new-sciences). This is...

...Check out Addgene's New Viral Service! References 1. Hay, R.J., Macy, M.L. & Chen, T.R. “Mycoplasma infection...contaminations.” Methods in Molecular Biology 946 (2013). 1-13. Pubmed PMID: 23179822. 5. Segura, M.M., Kamen,...Production, concentration and titration of pseudotyped HIV-1-based lentiviral vectors."Nature protocols 4.4 (2009...Seye, A.K., Majdoul, S., Martin, S., Merten, O.W., Galy, A., Fenard, D. ”Influence of mildly acidic pH conditions...

...linker (figure 1). In fact, for several FRET biosensors (yellow cameleon 3.60, EPAC, and Galphai), the C-terminus...fluorescent protein are relatively close together (figure 1). Where should the fluorescent protein be inserted...fluorescent protein database." Nature methods (2019): 1. PubMed PMID: 30886412. Mastop, Marieke, et al. "A...

...Article contributed by Susanna Bachle Figure 1: Initial steps in the CRISPR-pooled screening using...as a drug-screening platform to identify new antifungals that target calcineurin. Current calcineurin ...calcineurin gene reporters are based on the bacterial βgal assay, and are not suited to high throughput screening...

...cleavage (Harrington et al., 2017). Figure 1: Anti-CRISPR proteins (Acr's) can block CRISPR activity... ways to anti-CRISPR proteins in your experiments 1. Reduce off-target effects Prolonged Cas activity ... Jiang F, Liu J-J, Bray NL, Rauch BJ, Baik SH, Nogales E, Bondy-Denomy J, Corn JE, Doudna JA (2017) Disabling...

...expression. Brown et al., Genesis 2014 Jan;52(1):39-48. APEX2 for proteomic mapping and electron...engineering cells that lack release factor one (RF-1; Bacterial strain EcAR7) and minimizing the set of... of human mitogen-activated ERK activating kinase 1 (MEK1) with either one or two phosphoserine residues...comprised of three sets of cloning vectors (Level 0, 1, or 2) which can be utilized in three successive assembly... vectors are directionally assembled into a Level 1 vector creating a single transcriptional unit (Ex:...coding region, and terminator). Next, up to six Level 1 modules can be similarly assembled into a Level 2 ...vectors to allow for additional iterations of Level 1 assembly if necessary. Combining multiple Level 2 ...

... to the development of resistance include (Figure 1): Over-prescription of antibiotics (for example, ... communication, and public health.     References 1. O'Neill, J. "Tackling drug-resistant infections globally... used to describe anti-parasitic drugs and anti-fungal drugs, because ‘antibiotic’ merely means that the...

...Figure 1). Clustered events are called a population.                             Figure 1: While..., Eguía, J., Gonzalez-Martinez, G., Alfaro, R., Galián Megías, J. A., Campillo, J., Moya-Quiles, M., Minguela...

...know that most cephalopods die after they lay their 1 clutch of eggs? Propagation is thus quite difficult...organism blog posts: Five Popular Model Organisms, Part 1 Five Popular Model Organisms, Part 2 ...next project. Gymnotiformes and Mormyridae (Jason Gallant) Weakly electric fish are excellent systems to ...

...$47,476 and the date for implementation was set for Dec 1 2016. In order to be exempted from the need to pay... these institutions (populations potentially from 1 to 5761, according to the NSF data) and therefore ...the time of writing responses to requests for the legal justification of this have not been received. Future...

...Pluronic-F68 NaCl MgCl 2 KCl Centrifugal filter units (MWCO 100 kDa) Reagent Preparation 1 M NaCl/PBS-MK buffer...gradient for AAV purification. Workflow Timeline Day 1: Purify Day 2: Buffer exchange and concentration Note...of NaCl, 26.3 mg of MgCl 2 and 14.91 mg of KCl in 1× PBS in a final volume of 100 mL. Sterilize by passing...Dissolve 26.3 mg of MgCl 2 , and 14.91 mg of KCl in 1× PBS in a final volume of 100 mL. Sterilize by passing... step: mix 4.5 mL of 60% iodixanol and 13.5 mL of 1 M NaCl/PBS-MK buffer 25% iodixanol step: mix 5 mL ...Hamilton needle, taking care to avoid bubbles (Figure 1). 8 mL of 15% iodixanol step 5 mL of 25% iodixanol...disturb the gradient!** Collect Fractions Option #1 Prepare a row of roughly 20 open 1.5 mL microcentrifuge...

...vectors (e.g. pBV-Luc) and gene silencing (e.g. pLKO.1 - TRC cloning vector). Check out our complete guide...integration into the fly genome and are under the Gal4 inducible UAS promoter. Other vectors can be expressed...

...and drawbacks of four split AAV vector approaches. 1. Overlapping  Overview: The overlapping strategy has...Adeno-Associated Virus Capsids. Human Gene Therapy Methods 27:1–12 . https://doi.org/10.1089/hgtb.2015.140 Frischmeyer...Expression from the hybrid vector, as measured by β-galactosidase activity, was 81% of that from a single vector...

... CMV immediate early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter...end of LexA DNA binding domain, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC...origin, forward primer GAL1 AATATACCTCTATACTTTAACGTC (Invitrogen) S. cerevisiae GAL1 promoter, forward primer...primer Gal10pro-F GGTGGTAATGCCATGTAATATG (Stratagene) S. cerevisiae GAL10 promoter, forward primer Gal4...GAGTAGTAACAAAGGTCAA 3' end of Gal4 DNA binding domain, forward primer Gal4-AD AATACCACTACAATGGAT (BD Biosciences...Biosciences) 3' end of Gal4 activation domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP...

...efficiently with adenovirus and AAV.   Table 1: Types of viruses and their features Choosing .... DOI: 10.1016/j.gendis.2017.04.001 Maetzig T, Galla M, Baum C, Schambach A. Gammaretroviral vectors:...