...portion of split mCherry, while a phosphobinding domain is fused to the C-terminal mCherry fragment. Upon...Plasmid 112031 pNAS1b split mCherry 14-3-3β ctrl Plasmid 112030 pNAS1b split mCherry NEDD4 WW2 neg ctrl Plasmid...112029 pNAS1b split mCherry NEDD4 WW2 pos ctrl Plasmid 111883 pNAS1b split mCherry NEDD4-2 WW2 Plasmid...Plasmid 111882 pNAS1b split mCherry NEDD4 WW2 Plasmid 111881 pNAS1b split mCherry 14-3-3σ Plasmid 111880 pNAS1b...into a second expression vector encoding a split mCherry fluorescent reporter, enabling the detection of...the phosphobinding domain and the phosphosite, mCherry fluorescence is restored, so interactions can be...pNAS1b split mCherry 14-3-3β Pooled Library 111704 Mode #1 Library Pooled Library 111705 Mode #2 Library...

... hSyn none rg* Zeng 55634 pAAV-EF1a-mCherry-IRES-Flpo EF1a mCherry (not a fusion tag) 1, rg* Deisseroth...Wilson EF1a Promoter 55632 pAAV-Ef1a-mCherry-IRES-Cre EF1a mCherry (not a fusion tag) 8, rg* Deisseroth... Syn none 9 Wilson 107312 AAV-hSyn-mCherry-P2A-Cre-WPRE Syn mCherry 1 Yang 107738 pAAV-hSyn-Cre-P2A-dTomato...

...forward primer mCherry-F CCCCGTAATGCAGAAGAAGA 3' end of mCherry, forward primer mCherry-R TTGGTCACCTTCAGCTTGG...TTGGTCACCTTCAGCTTGG 5' end of mCherry, reverse primer MT Forward CATCTCAGTGCAACTAAA (Invitrogen) Drosophila metallothionein...

...p2A-ferritin-p2A-mCherry Mammalian Expression 74308 pcDNA3.0-Magneto2.0-p2A-mCherry Mammalian Expression...and named it Magneto 2.0. Using Magneto2.0-p2A-mCherry constructs, the lab verified that Magneto2.0 was...Expression 74334 pCR8-Magneto2.0-p2A-mCherry Gateway 74333 pCR8-Magneto2.0 Gateway 74307 pAAV-CMV-DIO-Magneto2.0...AAV 74302 pDestTol2CG2-Neurog1-Magneto2.0-p2A-mCherry-pA Zebrafish Expression   Human kinase domain...addition, some versions of the mAID vectors come with mCherry2 or mClover fluorescent proteins allowing you to...

...were also able to introduce a longer insertion (mCherry) using IDT Megamer long ssDNA with 100 nt homology...

... Myc, etc.) and fluorescent protein tags (GFP, mCherry, etc.). Fluorescent tags are primarily used for...

...paavCAG-iCre iCre CAG AAV Kim 55632 pAAV-Ef1a-mCherry-IRES-Cre Cre and mCherry coexpression EF-1 alpha AAV Deisseroth...84032 pHD066 mCherry-Cre fusion and Venus Elastase Zebrafish Stainier 84033 pHD157 mCherry-Cre fusion and...Mammalian Hirrlinger 107312 AAV-hSyn-mCherry-P2A-Cre-WPRE mCherry and Cre; expressed in neurons hSyn AAV... AAV Yang 107313 AAV-aCamkII-mCherry-P2A-Cre-WPRE-BGH-polyA mCherry and Cre; expressed in excitatory neurons...beetle) Averof 119868 pGEM-NLS-Cre-2A-mCherry-FKF NLS-Cre, mCherry T7 Bacterial Sauka-Spengler 119971 GAG-CRErec...Mammalian Capecchi 126006 pAAV2-ProC3-Cre/mCherry Cre and mCherry ProC3 AAV Roska 126700 pHAGE2-EF1aL-Cre-IRES-NeoR-W...yeast Gal1 Yeast Sandmeyer 26888 pmCherry-CRY2-CreN CRY2-CreN and mCherry coexpression; Light inducible;...

... pyogenes mCherry Luikart pDECKO_mCherry 78534 Mammalian hU6 none S. pyogenes Puro, mCherry Guigo BPK3079...BbsI)_CBh-Cas9-T2A-mCherry-H1-(BamHI) 64217 Mammalian BbsI yes, cut S. pyogenes mCherry Kuhn pU6-(BbsI)_...CBh-Cas9-T2A-mcherry-P2A-Ad4E1B 64221 Mammalian see plasmid page yes, cut S. pyogenes mCherry Kuhn pU6-(...pU6-(BbsI)_CBh-Cas9-T2A-mCherry 64324 Mammalian BbsI yes, cut S. pyogenes mCherry Kuhn pEX-A-U6-gRNA 65626...CBh-Cas9-T2A-mcherry-P2A-Ad4E4orf6 64222 Mammalian see plasmid page yes, cut S. pyogenes mCherry Kuhn AAV:...pyogenes EGFP Jackson AIO-mCherry 74120 Mammalian U6x2 yes, nick S. pyogenes mCherry Jackson pMZ376 74213 ...pyogenes mCherry Savage pBLO1808_arC9_2xNLS_human 74491 Mammalian U6 yes, cut S. pyogenes mCherry Savage...

...pAAV-CaMKIIa-mCherry CamKIIa mCherry Control Deisseroth 114470 pAAV-Ef1a-mCherry EF1a mCherry Control Deisseroth...pAAV-hSyn-DIO-hM3D(Gq)-mCherry Syn Activator, Cre-dependent DREADD Roth 44362 pAAV-hSyn-DIO-hM4D(Gi)-mCherry Syn Inhibitor...Activator C1V1 Dimidschstein 135634 pAAV-S5E2-ChR2-mCherry E2 regulatory element Activator ChR2 Dimidschstein...

...plasmids for purification of tTALE-eGFP and tTALE-mCherry. In comparison to intercalating fluorescent dyes...

... blue light sensitive cation channel, fused to mCherry to the brain tissue. They performed optical stimulation...

...sensor for zinc using variants of mOrange2 and mCherry as donor and acceptor domains. He says, these new...

...FUGW-APPwt-T2A-mCherry APP mCherry UbC Alzheimer's Ronald Hart 190804 FUGW-APPSwe-T2A-mCherry APP mCherry UbC Alzheimer's...-T2A-mCherry APP mCherry UbC Alzheimer's Ronald Hart 190807 FUGW-APOE-E2-T2A-mCherry APOE mCherry UbC ...T2A-mCherry APOE mCherry UbC Alzheimer's Ronald Hart 190809 FUGW-APOE-E4-T2A-mCherry APOE mCherry UbC ...115331 pLNCX2-mCherry-CHMP2B CHMP2B mCherry CMV ALS Sanford Simon 115333 pLNCX2-mCherry-CHMP2B-siRNAres...Lazarou 119683 pBMN mCherry-OPTN(D474N) OPTN mCherry ALS Michael Lazarou 119684 pBMN mCherry-OPTN(F178A/D474N...Calamai 196704 mCherry-APP-mGFP APP GFP, mCherry CMV Alzheimer's Martino Calamai 196705 mCherry-APPP1-mGFP... CMV Parkinson's Richard Youle 23956 mCherry-Parkin PRKN mCherry CMV Parkinson's Richard Youle 23966 pTreTight-Htt94Q-CFP...

...Gordon Fishell 83898-AAV1 pAAV-mDlx-ChR2-mCherry-Fishell-3 ChR2-mCherry fusion expression in forebrain GABA-ergic...Gordon Fishell 83898-AAV9 pAAV-mDlx-ChR2-mCherry-Fishell-3 ChR2-mCherry fusion expression in forebrain GABA-ergic... Fishell 83898-AAVrg pAAV-mDlx-ChR2-mCherry-Fishell-3 ChR2-mCherry fusion expression in forebrain GABA-ergic...135634-AAV1 pAAV-S5E2-ChR2-mCherry AAV vector to drive the expression of ChR2-mCherry in PV cortical interneuronsunder...135634-AAV9 pAAV-S5E2-ChR2-mCherry AAV vector to drive the expression of ChR2-mCherry in PV cortical interneuronsunder...-PHPeB pAAV-S5E2-ChR2-mCherry AAV vector to drive the expression of ChR2-mCherry in PV cortical interneuronsunder...expression. Bryan Roth 75033-AAV1 pAAV CD68-hM4D(Gi)-mCherry Expression of hM4D(Gi) using the CD68 promoter....

...(E123A)-mCherry Karl Deisseroth AV-1-35512 35512-AAV1 pAAV-CaMKIIa-hChR2(E123T/T159C)-mCherry Karl Deisseroth...20297-AAV1 pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA Karl Deisseroth AV-1-20298P 20298-AAV1...AV-1-26975 26975-AAV1 pAAV-CaMKIIa-hChR2(H134R)-mCherry Karl Deisseroth AV-1-35503 35503-AAV1 pAAV-Ef1a-DIO...20297-AAV5 pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA Karl Deisseroth AV-5-20298P 20298-AAV5...AV-5-26975 26975-AAV5 pAAV-CaMKIIa-hChR2(H134R)-mCherry Karl Deisseroth AV-5-35509 35509-AAV5 pAAV-Ef1a-DIO...20297-AAV9 pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA Karl Deisseroth AV-9-20298P 20298-AAV9...AV-9-26975 26975-AAV9 pAAV-CaMKIIa-hChR2(H134R)-mCherry Karl Deisseroth AV-9-35497 35497-AAV9 pAAV-Ef1a-DIO...

...followed by an internal ribosomal entry site and mCherry. If a variant has wild-type levels of abundance...fluorescence-activated cell sorting into four bins based on their eGFP:mCherry ratios. Genomic DNA from each bin are then extracted...

...The pooled library comes either with or without mCherry and GFP fluorescent controls. Alternatively, you...

...pegRNA-H1-nick sgRNA-mCherry Mammalian, AAV hU6 + H1 pegRNA + nicking sgRNA No mCherry Hyongbum Kim pDAS12069...pDAS12069_U6-pegRNA-mCherry Mammalian hU6 pegRNA BpiI for pegRNA, Esp31 for PBS-RT No mCherry Ervin Welker pDAS12222...

...pCS2+8NmCherry - Zebrafish/Xenopus/C.elegans/Sea urchin pET mCherry LIC cloning vector (u-mCherry) - Bacterial...Mammalian Retroviral Expression mCherry 587 610 16 4.5 15 min Monomer pcDNA3 mCherry LIC cloning vector (6B) ... for C. elegans expression pHT101-mCherry - N- or C-terminal mCherry for C. elegans expression Yeast Thorn...Mammalian Expression pLV-mCherry - Mammalian Lentiviral Expression pCS2+8CmCherry - Zebrafish/Xenopus/C....Lab Mammalian Plasmids - Includes tagging with mCherry, mCitrine, mCerulean Davidson Lab Plasmids - Includes... - For multicistronic expression of GFP and/or mCherry, with neomycin cassette Zebrafish, Sea urchin, ...Hamdoun Lab Plasmids - Set includes tagging with mCherry, Cerulean, Citrine, and eGFP pPD95_75 - C-terminal...

... open for a longer duration upon activation. p-mcherry-C1-iC++_CA - A slow cycling (open for minutes) ...